ID: 1134600596

View in Genome Browser
Species Human (GRCh38)
Location 16:15530665-15530687
Sequence CATGAGAGGGACCCGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134600587_1134600596 -5 Left 1134600587 16:15530647-15530669 CCCATAATCCCCATATGTCATGA No data
Right 1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG No data
1134600582_1134600596 24 Left 1134600582 16:15530618-15530640 CCCACCCAAATCTTATCCTGAAT 0: 13
1: 559
2: 8491
3: 11439
4: 10379
Right 1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG No data
1134600588_1134600596 -6 Left 1134600588 16:15530648-15530670 CCATAATCCCCATATGTCATGAG No data
Right 1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG No data
1134600585_1134600596 19 Left 1134600585 16:15530623-15530645 CCAAATCTTATCCTGAATTGTAA No data
Right 1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG No data
1134600583_1134600596 23 Left 1134600583 16:15530619-15530641 CCACCCAAATCTTATCCTGAATT 0: 10
1: 595
2: 8514
3: 11632
4: 9944
Right 1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG No data
1134600581_1134600596 25 Left 1134600581 16:15530617-15530639 CCCCACCCAAATCTTATCCTGAA No data
Right 1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG No data
1134600586_1134600596 8 Left 1134600586 16:15530634-15530656 CCTGAATTGTAATCCCATAATCC No data
Right 1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG No data
1134600584_1134600596 20 Left 1134600584 16:15530622-15530644 CCCAAATCTTATCCTGAATTGTA No data
Right 1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134600596 Original CRISPR CATGAGAGGGACCCGGTGGA AGG Intronic
No off target data available for this crispr