ID: 1134602927

View in Genome Browser
Species Human (GRCh38)
Location 16:15547641-15547663
Sequence CATTAAAAGCTGAAAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134602927_1134602933 22 Left 1134602927 16:15547641-15547663 CCAGCCACTTTCAGCTTTTAATG No data
Right 1134602933 16:15547686-15547708 TGCTGAAATAGCTGTCATGGAGG No data
1134602927_1134602931 19 Left 1134602927 16:15547641-15547663 CCAGCCACTTTCAGCTTTTAATG No data
Right 1134602931 16:15547683-15547705 CCCTGCTGAAATAGCTGTCATGG 0: 1
1: 0
2: 0
3: 6
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134602927 Original CRISPR CATTAAAAGCTGAAAGTGGC TGG (reversed) Intronic
No off target data available for this crispr