ID: 1134602931

View in Genome Browser
Species Human (GRCh38)
Location 16:15547683-15547705
Sequence CCCTGCTGAAATAGCTGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134602928_1134602931 15 Left 1134602928 16:15547645-15547667 CCACTTTCAGCTTTTAATGTTTA No data
Right 1134602931 16:15547683-15547705 CCCTGCTGAAATAGCTGTCATGG 0: 1
1: 0
2: 0
3: 6
4: 150
1134602926_1134602931 20 Left 1134602926 16:15547640-15547662 CCCAGCCACTTTCAGCTTTTAAT No data
Right 1134602931 16:15547683-15547705 CCCTGCTGAAATAGCTGTCATGG 0: 1
1: 0
2: 0
3: 6
4: 150
1134602925_1134602931 24 Left 1134602925 16:15547636-15547658 CCTGCCCAGCCACTTTCAGCTTT No data
Right 1134602931 16:15547683-15547705 CCCTGCTGAAATAGCTGTCATGG 0: 1
1: 0
2: 0
3: 6
4: 150
1134602927_1134602931 19 Left 1134602927 16:15547641-15547663 CCAGCCACTTTCAGCTTTTAATG No data
Right 1134602931 16:15547683-15547705 CCCTGCTGAAATAGCTGTCATGG 0: 1
1: 0
2: 0
3: 6
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134602931 Original CRISPR CCCTGCTGAAATAGCTGTCA TGG Intronic
904034025 1:27549658-27549680 CCGTGCTGTAGTAGCTGCCACGG + Exonic
905825428 1:41022815-41022837 CTGTGCAGAAATAGCTGTCCGGG + Exonic
906728613 1:48062354-48062376 CCCACCTGAAGTAGCAGTCATGG + Intergenic
908291845 1:62675433-62675455 CCCTGGTGAAATACCTGTTCAGG - Intronic
909792126 1:79693093-79693115 CCCTGGTCATATAGCTGCCATGG + Intergenic
912681980 1:111734595-111734617 CAGTGCTGAAAGAGCTGTCGTGG - Intronic
914886271 1:151586904-151586926 CTCTGTTGAAATATCTCTCAGGG + Intergenic
917541550 1:175919524-175919546 CCCTGATCAAGTAGATGTCAAGG - Intergenic
918990012 1:191685651-191685673 ACCTACTGAAATACCTGCCATGG - Intergenic
919908387 1:202094110-202094132 CTCTGTGGAAATAGCTGGCAGGG - Intergenic
920344751 1:205299015-205299037 CCCTGCTGAGATAGCACTGATGG + Intergenic
923146398 1:231201683-231201705 CCCAGCTCACATGGCTGTCAGGG - Intronic
923225367 1:231934158-231934180 CCGTGCAGCAATAGCTGTGAGGG + Intronic
1065429679 10:25640599-25640621 CAGTGCTGAAACAGCTGTTATGG - Intergenic
1069147076 10:64906541-64906563 CAGTGCTGAAACAGTTGTCATGG + Intergenic
1072288665 10:93941723-93941745 CCCTTCTGAAATAGTTGGCTCGG - Intronic
1073527623 10:104199749-104199771 CATTGCTGAAACAGTTGTCATGG - Intronic
1073850945 10:107617464-107617486 CCCTCCTGAAAGACCTGTCTGGG - Intergenic
1075791166 10:125085307-125085329 AGCTGCTTAAATTGCTGTCAGGG - Intronic
1076486322 10:130820985-130821007 CCCTGCTCAGTTATCTGTCATGG + Intergenic
1080793725 11:35543813-35543835 CAGTGCTGAAATAGTTGTTATGG + Intergenic
1083058762 11:59847940-59847962 CCCTACGGAAATAGCTGGGAGGG + Intergenic
1086079742 11:82890727-82890749 CTCTGAGGAAATTGCTGTCAAGG + Intronic
1086512570 11:87575080-87575102 CCCTTCATAAATAGCAGTCAAGG + Intergenic
1088897525 11:114089639-114089661 GGCTGCTGAAGTAGCTGGCAAGG + Intronic
1090557174 11:127888671-127888693 CAGTGCTGAAACAGTTGTCATGG + Intergenic
1091509068 12:1103378-1103400 CTCTGCTGAAAACCCTGTCATGG - Intronic
1093220338 12:16413291-16413313 CACTGCTCAGGTAGCTGTCAAGG + Intronic
1097607092 12:61768908-61768930 CCCTGCTGAGAAAGCAGGCAGGG - Intronic
1099132908 12:78858838-78858860 CCCAGCAGAAATGTCTGTCATGG - Intergenic
1100935517 12:99660913-99660935 CAGTGCTGAAACAGTTGTCATGG - Intronic
1101578800 12:106022895-106022917 CCCTGCTGTAAGAGCTGAAAGGG + Intergenic
1103100654 12:118171703-118171725 CCCTGCTTAAAAATCTCTCATGG + Intronic
1104014818 12:124954732-124954754 AACTGCTTAAATAGCTGCCAAGG + Intronic
1104931254 12:132340607-132340629 CCCTGCAGAAGGAGCCGTCACGG + Intergenic
1106180856 13:27368190-27368212 TCCCTCTGAAATAGCTCTCATGG - Intergenic
1110444962 13:75569963-75569985 CCCAGCTGAACTAGCTAACAGGG - Intronic
1112434060 13:99378168-99378190 CCATGGTGAAATAGCTGAGATGG - Intronic
1112746428 13:102532398-102532420 CCCTGCTAAAAAATCTGTGATGG - Intergenic
1113339020 13:109404299-109404321 CCCTGCTGCAACTGCTGTGATGG - Intergenic
1116506914 14:45694733-45694755 CCCTGCTTAAATTACTGACACGG - Intergenic
1117145646 14:52834627-52834649 TCCAGTTGAAATTGCTGTCATGG + Intergenic
1117696283 14:58367733-58367755 CCCTGCTAAAATAACAGTAAAGG + Intronic
1120859156 14:89239117-89239139 CCTTGCTGAAAAAGCTCTGAGGG - Intronic
1121169623 14:91842630-91842652 CCCTGAAGAAATAGCTATCCAGG + Intronic
1122717113 14:103702391-103702413 CCCTGGTGAGATAGCTGTGTTGG - Intronic
1123539591 15:21274741-21274763 CAGTGCTGAAACAGTTGTCATGG + Intergenic
1128167145 15:65475599-65475621 CCTTGTTGAAATAGCTGATATGG - Intronic
1128527742 15:68423894-68423916 CCCTGCTGAAATTGAAGTGAGGG - Intronic
1130755066 15:86754572-86754594 CCCTGCAGGAATCTCTGTCAGGG - Intronic
1130885563 15:88089860-88089882 ACCTGCTTAAATGGCTGCCAGGG + Intronic
1202947901 15_KI270727v1_random:1900-1922 CAGTGCTGAAACAGTTGTCATGG + Intergenic
1134602931 16:15547683-15547705 CCCTGCTGAAATAGCTGTCATGG + Intronic
1136777191 16:32878365-32878387 CCCAGCTGAAATATTTGTCTTGG + Intergenic
1136893432 16:33983148-33983170 CCCAGCTGAAATATTTGTCTTGG - Intergenic
1137352258 16:47723756-47723778 CCCTTCTGCAATATTTGTCATGG + Intergenic
1137741024 16:50774247-50774269 TCCTTCTGAAGTATCTGTCATGG + Intronic
1203079605 16_KI270728v1_random:1140474-1140496 CCCAGCTGAAATATTTGTCTTGG + Intergenic
1144173250 17:12680526-12680548 CTCTGCAGCAATAGCTTTCAAGG + Intronic
1144506418 17:15835006-15835028 CCCTGTTGAAACAGCAGTGAGGG + Intergenic
1148525809 17:48332682-48332704 CTCTGCAGATATAGCTTTCATGG + Intronic
1149389848 17:56177484-56177506 CCCTGTTGAAATAGGTTACAAGG + Intronic
1154047825 18:10923764-10923786 CCCTGCTGAAATTGCAGGCATGG - Intronic
1155161772 18:23201949-23201971 CCCTGATGGAACAGCAGTCATGG + Intronic
1155821794 18:30387015-30387037 CCCTGCTGTAATAGCAGTTGCGG - Intergenic
1157776447 18:50400349-50400371 CAGTGCTGAAATAGTTGTTATGG + Intergenic
1157976937 18:52338722-52338744 ACCTTCTGAAATAGCTTACATGG - Intergenic
1158874682 18:61721946-61721968 CCCTCTTGAAATAACTATCAAGG + Intergenic
1162043958 19:7986680-7986702 CCCTGCTGACATAAATGTCCTGG - Intronic
1167307766 19:48719121-48719143 CCCTGCTGAATTCACTCTCAGGG - Intronic
926832117 2:16975275-16975297 CACTGCTGAAAAAGTTGTCTTGG - Intergenic
930889220 2:56363386-56363408 ACCTGCTGAAAGATCTATCATGG - Intronic
935271123 2:101435278-101435300 CCGAGCTGAAAAAGCTGACACGG + Intronic
935673679 2:105576279-105576301 CCCTGCTCACAGAGCAGTCAAGG - Intergenic
936652548 2:114445480-114445502 CATTGCTAAAATAGCTGTAAAGG + Intronic
936787499 2:116111622-116111644 CTCTGCTGACTTACCTGTCAGGG - Intergenic
937284993 2:120745008-120745030 CCTTGCTGCAACAGCTGTCCAGG - Intronic
940008202 2:149029313-149029335 CCCACCTGAAATGGCTCTCAGGG + Intergenic
940387552 2:153091001-153091023 CCCTGCTGAAAAAGCAAGCATGG + Intergenic
942226371 2:173820149-173820171 CTCTGCAGAAATTGTTGTCAGGG + Intergenic
942402812 2:175621464-175621486 CCCTGCAGAAATGGCTACCATGG - Intergenic
942599523 2:177626709-177626731 CCCTGCAGAGACAGCTGTAAAGG + Exonic
944602759 2:201320398-201320420 CCCTGCAGAGATAGCAATCACGG - Intronic
948076764 2:235171008-235171030 TCCTGGTGAAATAGCTGAGAAGG - Intergenic
948485637 2:238279148-238279170 CTCTGCTGAAAACGCTGTCCTGG - Intronic
948978802 2:241482066-241482088 CTCTGCTCAAATAACTGGCATGG - Intronic
1169236792 20:3936149-3936171 CCTTGCTGAGGTAGCTTTCAGGG + Intronic
1175564848 20:59965378-59965400 CCCTGTTTTAATAGCTATCATGG - Intronic
1177027030 21:15932906-15932928 CAGTGCTGAAACAGTTGTCACGG - Intergenic
1179115893 21:38491694-38491716 CCCTGCTGAAAGACTTGTTAAGG + Intronic
1181742728 22:24934259-24934281 CAGTGCTGAAACAGTTGTCATGG + Intergenic
1182333659 22:29569034-29569056 CCCTGCTCAAATACCTGTCCTGG - Intronic
1184192524 22:42904455-42904477 CCTTGCTGGAAGAGCTGCCATGG + Intronic
953131450 3:40143263-40143285 TCCTGCTGAAATAGAGGACAGGG - Intronic
953208775 3:40855785-40855807 CCCAGCTGATTTAGGTGTCATGG - Intergenic
954493958 3:50935262-50935284 CACTGCTGAAATGCCTGTTAGGG - Intronic
955485233 3:59428217-59428239 CCCCCCTGAGATTGCTGTCAGGG - Intergenic
957578166 3:82035698-82035720 CTCTGCTGAACTAGATGTCCTGG + Intergenic
958486761 3:94722072-94722094 CCCTTGTGAAATAACTGCCAAGG - Intergenic
960549773 3:118961960-118961982 TCCTTCTGAAATAACTTTCATGG - Intronic
960901155 3:122555726-122555748 AGCTGGTGAGATAGCTGTCACGG - Exonic
962204908 3:133426288-133426310 CCCTGCTGACGTGCCTGTCAAGG + Intronic
962533152 3:136302205-136302227 ACTTGCGGAAATATCTGTCATGG + Intronic
965106390 3:164360520-164360542 CACTGCTGAAAAAGCTTTGATGG + Intergenic
971780571 4:31028964-31028986 CCCTGCTGAATCAGCTGTTCTGG - Intronic
972932591 4:44091878-44091900 CACTGCTGAAATAGTTGTTGCGG - Intergenic
974388359 4:61232094-61232116 CCCTTCTGGGATTGCTGTCAAGG + Intronic
975217067 4:71768300-71768322 CCCTGGTGTCATAGCAGTCAGGG + Exonic
978939660 4:114421039-114421061 CAGTGCTGAAACAGTTGTCATGG + Intergenic
983940904 4:173533166-173533188 CCATGCTGACATCGATGTCAGGG - Intergenic
986841446 5:11702267-11702289 CACAGCTGATACAGCTGTCAAGG + Intronic
987537524 5:19207638-19207660 CCTTCTTGAAATAGCTTTCAAGG - Intergenic
990103869 5:52231044-52231066 CACTGATGAAATAATTGTCAAGG + Intergenic
990524933 5:56615895-56615917 CCCTGCTGAAATCGAGGCCATGG - Intergenic
990872181 5:60444292-60444314 CCCTGGTGAAATCACTGGCAGGG - Intronic
992776532 5:80093955-80093977 CAGTGCTGAAACAGTTGTCATGG - Intergenic
994661403 5:102658642-102658664 TCCTAATGCAATAGCTGTCATGG + Intergenic
994682464 5:102906292-102906314 TCCTGCTGAAATAGCTAGCTGGG - Intronic
996025248 5:118638465-118638487 CCCTGCTGAAAAAGCAAGCAGGG - Intergenic
997676230 5:135715093-135715115 CCCTGCTGCAATAGCCTTCTTGG - Intergenic
998923735 5:147099726-147099748 CAATGCTGAAACAGCTGTCTGGG + Intergenic
999545011 5:152618225-152618247 CCCTGCTGAAAGACCTACCAGGG + Intergenic
1001225553 5:169941648-169941670 CCCTGCTGGAGGAGCCGTCACGG - Intronic
1002703339 5:181142812-181142834 CCCTGCAGAAATGCCTGTCAGGG + Intergenic
1004924933 6:20407082-20407104 CCCTGCTGAAATAGCACCTATGG - Intronic
1007037057 6:38685112-38685134 CTCTGCTGACATTGCTCTCATGG - Intronic
1008651798 6:53571078-53571100 CAGTGCTGAAACAGTTGTCATGG + Intronic
1013469464 6:110449040-110449062 CCCTTCTGATATATCTGTCAAGG - Intronic
1014177774 6:118349087-118349109 CTCTGCTGAAACAACTTTCATGG - Intergenic
1015017328 6:128429325-128429347 CCCTGGTGACAGAGCTGACAGGG + Intronic
1019839575 7:3426847-3426869 CTCTGCTTAAATCCCTGTCATGG + Intronic
1024743127 7:52376779-52376801 TCCTCCAGAAACAGCTGTCAGGG + Intergenic
1026162314 7:67880615-67880637 CTCTGCTGAAATAGACATCAAGG - Intergenic
1028499500 7:91503022-91503044 CCCTGCTAAAATATGTGTCTGGG - Intergenic
1032196798 7:129794096-129794118 CCCTGCTGAATGGGCTGTGAGGG - Intergenic
1032844374 7:135740034-135740056 CTCTGCTGAAATACCTGGCTAGG - Intronic
1033048896 7:137986508-137986530 CCCTGCTGTCATGGCAGTCATGG - Intronic
1039144595 8:34433042-34433064 ACCTGCTGGAGTTGCTGTCACGG - Intergenic
1040433892 8:47370912-47370934 CCCTGTTGAGATAGTTGTCTAGG + Intronic
1042744876 8:72096960-72096982 CAGTGCTGAAACAGCTGTCATGG + Intronic
1043550144 8:81362319-81362341 CTCTGCAGAAACAGCTGCCAGGG + Intergenic
1043684647 8:83070594-83070616 CCCTACCTTAATAGCTGTCAAGG + Intergenic
1044063326 8:87666781-87666803 CTCTGCTGAAATTGGCGTCATGG - Intergenic
1046400228 8:113695782-113695804 TCCTCTTGAACTAGCTGTCAGGG + Intergenic
1053231802 9:36416454-36416476 CCCTGCTGAGAAAGCAGGCAAGG + Intronic
1055539483 9:77287722-77287744 CCCTGTTGAAAGAGCTTTCCAGG + Intronic
1058267550 9:102923490-102923512 CCTTGCTAAGATAGCTGTCTAGG + Intergenic
1058633402 9:107012492-107012514 CCCTCCTGAAAAAGCTGATATGG - Exonic
1059849135 9:118317490-118317512 CTCTGATGGAATAGCTGTCAGGG + Intergenic
1060197271 9:121631871-121631893 CCCTGCTGAAAGCCCTGCCACGG - Intronic
1061407072 9:130398383-130398405 CCCTGCTGGAAGCGCTGTCTCGG + Intronic
1185799282 X:2995184-2995206 CAGTGCTGAAACAGATGTCATGG + Intergenic
1188416722 X:29944318-29944340 TCCTGCTGAAATGGTGGTCAGGG + Intronic
1188725435 X:33577299-33577321 CCAGGCTGAAATGGCTGACATGG - Intergenic
1193374670 X:80744160-80744182 CTCTGCTGAAATTTCTGACATGG - Exonic
1197376502 X:125688475-125688497 CAGTGCTGAAAGAGTTGTCATGG - Intergenic
1201433073 Y:13925722-13925744 GCCTTGTGAAATAGCTTTCAAGG + Intergenic