ID: 1134602933

View in Genome Browser
Species Human (GRCh38)
Location 16:15547686-15547708
Sequence TGCTGAAATAGCTGTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134602928_1134602933 18 Left 1134602928 16:15547645-15547667 CCACTTTCAGCTTTTAATGTTTA No data
Right 1134602933 16:15547686-15547708 TGCTGAAATAGCTGTCATGGAGG No data
1134602925_1134602933 27 Left 1134602925 16:15547636-15547658 CCTGCCCAGCCACTTTCAGCTTT No data
Right 1134602933 16:15547686-15547708 TGCTGAAATAGCTGTCATGGAGG No data
1134602927_1134602933 22 Left 1134602927 16:15547641-15547663 CCAGCCACTTTCAGCTTTTAATG No data
Right 1134602933 16:15547686-15547708 TGCTGAAATAGCTGTCATGGAGG No data
1134602926_1134602933 23 Left 1134602926 16:15547640-15547662 CCCAGCCACTTTCAGCTTTTAAT No data
Right 1134602933 16:15547686-15547708 TGCTGAAATAGCTGTCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134602933 Original CRISPR TGCTGAAATAGCTGTCATGG AGG Intronic
No off target data available for this crispr