ID: 1134607514

View in Genome Browser
Species Human (GRCh38)
Location 16:15582747-15582769
Sequence AAGGATCACCAAGATAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134607514_1134607518 -10 Left 1134607514 16:15582747-15582769 CCTACTTTATCTTGGTGATCCTT No data
Right 1134607518 16:15582760-15582782 GGTGATCCTTGGAAGAGCTGGGG No data
1134607514_1134607521 27 Left 1134607514 16:15582747-15582769 CCTACTTTATCTTGGTGATCCTT No data
Right 1134607521 16:15582797-15582819 AGACCTGCCTCATACTTTGTGGG No data
1134607514_1134607520 26 Left 1134607514 16:15582747-15582769 CCTACTTTATCTTGGTGATCCTT No data
Right 1134607520 16:15582796-15582818 GAGACCTGCCTCATACTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134607514 Original CRISPR AAGGATCACCAAGATAAAGT AGG (reversed) Intronic
No off target data available for this crispr