ID: 1134612575

View in Genome Browser
Species Human (GRCh38)
Location 16:15621622-15621644
Sequence TGCAATCATCACAAGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134612575 Original CRISPR TGCAATCATCACAAGGGGGT GGG Intronic
904084207 1:27892985-27893007 TGGAATCAGGACAAGGGTGTTGG + Intronic
905794100 1:40805753-40805775 TGCAATCATGCTAAGGGGTTTGG + Intronic
906357457 1:45119273-45119295 TGGAATAAGAACAAGGGGGTTGG - Intronic
915844968 1:159253060-159253082 TGCAATCAGCCCAAGGTGGAGGG - Intergenic
920655313 1:207869729-207869751 TGCAATTCTCAGAAGGGTGTAGG - Intergenic
921058958 1:211566297-211566319 TGTAATCCTCACAAGGGGATTGG + Intergenic
1063940773 10:11126769-11126791 TCCAATTATTACAAGGGAGTAGG - Intronic
1077725471 11:4671020-4671042 TGCCATCATCCCATGGGGGATGG + Intergenic
1081418502 11:42843860-42843882 TGTAAGCATCACAAGGCAGTGGG + Intergenic
1084187678 11:67483485-67483507 GTCAGTCATCACAAGCGGGTTGG + Intronic
1089137326 11:116260113-116260135 TGGAAGCATCAGATGGGGGTTGG + Intergenic
1089672031 11:120063250-120063272 TCCAAACATCACTTGGGGGTTGG - Intergenic
1092995975 12:13951013-13951035 TGGAATGTTCACAAGGGAGTGGG - Intronic
1094472663 12:30817915-30817937 TGGAATCATCAAAAGGGTGATGG - Intergenic
1098787899 12:74782381-74782403 TGCAATCAGCTGCAGGGGGTTGG + Intergenic
1099362645 12:81724779-81724801 TGCAATAAACATAAGGGGGAAGG + Intronic
1101299090 12:103459401-103459423 TACACTCATCACAAAGGGGATGG - Intronic
1101401005 12:104386672-104386694 ACCAATCATCAGAAGGGGGTGGG - Intergenic
1103275678 12:119709954-119709976 TGCAATCAGGACAAAGGGTTTGG + Intronic
1104092089 12:125525891-125525913 TGCAATAATCACAAGGGAAGGGG - Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1112604983 13:100895710-100895732 TGCAATGAACACAACGGTGTGGG - Intergenic
1118240410 14:64051150-64051172 TGAAAAGATGACAAGGGGGTTGG + Intronic
1118986829 14:70763343-70763365 TGCCATCATCACTAGGTGATAGG - Intronic
1119674014 14:76540260-76540282 TCCAATCAAAACAAGGGGCTGGG + Intergenic
1119772466 14:77228886-77228908 TACAATCCTGACAAGGGGGCAGG + Intronic
1121791334 14:96701818-96701840 TGCAGGCAGCACAAGGGGTTGGG + Intergenic
1121817858 14:96942267-96942289 GGAAATCATCAGAAGCGGGTGGG - Intergenic
1122384287 14:101333499-101333521 TGCACTCACCACATGGGGTTGGG + Intergenic
1122384521 14:101334829-101334851 TCCAAACATCACCAGGAGGTAGG + Intergenic
1123158436 14:106252939-106252961 TGCAAGAATCACAAAGGGGAAGG - Intergenic
1123839219 15:24229651-24229673 TGCAATCATCACAGGGTCCTGGG + Intergenic
1128770978 15:70282372-70282394 TGTAATCTTCACAGGGGTGTTGG - Intergenic
1128928129 15:71677657-71677679 AACAATCAGCAGAAGGGGGTGGG - Intronic
1129244588 15:74271743-74271765 GGCAATCACCACTATGGGGTTGG - Exonic
1129799017 15:78399527-78399549 TGCCATCATCAGAAACGGGTTGG + Intergenic
1129908414 15:79206253-79206275 TGTCATCAACACAAGGGGGGGGG - Intergenic
1133072516 16:3255947-3255969 TGCAATCATATGAACGGGGTTGG - Intronic
1133258660 16:4534410-4534432 TGCAGTGATCACAATGGGGCTGG + Intronic
1134612575 16:15621622-15621644 TGCAATCATCACAAGGGGGTGGG + Intronic
1135722743 16:24831065-24831087 TGCAATGATGGCAAGGGGCTTGG - Intergenic
1138504071 16:57468435-57468457 TGCAAACATCAAAAGAGTGTTGG + Intronic
1147675841 17:42204971-42204993 TGCAGTCATCAAAATGAGGTTGG + Intronic
1150036073 17:61799861-61799883 TGCCAGCATCACATGGGAGTTGG - Intronic
1154325299 18:13386816-13386838 AGCAATCCTCACAAAGGGCTTGG - Intronic
1156856181 18:41783791-41783813 TGCCATCATCACAAAGAGGGAGG - Intergenic
1159074522 18:63665558-63665580 TGCAATCATCACAGGGTCCTGGG - Intronic
1160246869 18:77166158-77166180 TGCATTCATCACAGGAGGGATGG + Intergenic
1163704426 19:18804073-18804095 TGAACCCATCACAAGGTGGTTGG + Intergenic
1167111119 19:47461970-47461992 TGCCATCATCACTAGGGAGGGGG + Intronic
927846413 2:26474621-26474643 TGCCATCTTCACCAGGGGTTTGG + Exonic
929248862 2:39731223-39731245 TGCCCTCTTCACAAGGGGGAGGG + Intergenic
929504974 2:42521349-42521371 TGCAATCATCACTAGGCCGATGG - Intronic
934880683 2:97974376-97974398 TGGAATCCTCAAAATGGGGTTGG + Intronic
938609587 2:132933764-132933786 TACAATCATCATAATGAGGTTGG - Intronic
940436669 2:153664502-153664524 CGCAATCATCACAAGGTCCTGGG + Intergenic
942385819 2:175441675-175441697 TGCTTTCATCAGAAGGGGGAAGG - Intergenic
943783058 2:191846263-191846285 TGAAATCTTCACACAGGGGTGGG - Intronic
945488616 2:210427807-210427829 TGCAATCATCACAAGGTCCTAGG + Intergenic
1172731398 20:37091797-37091819 TGCAATAATCTAAAAGGGGTGGG + Intronic
1174143724 20:48435607-48435629 TTTAATGATCACAAGTGGGTTGG + Intergenic
1177772459 21:25531668-25531690 TGCATACATGACAAGGGGGTAGG + Intergenic
1182540952 22:31041662-31041684 TGAACTCATCACCAAGGGGTTGG + Intergenic
950031738 3:9858330-9858352 TGGAAGCATCACAGGGGGGAGGG + Intergenic
954507178 3:51087940-51087962 TGCAATAAACACAAGGGTGCTGG - Intronic
958776203 3:98485975-98485997 TGCAAACCTCAGAAGTGGGTTGG - Intergenic
966209639 3:177439837-177439859 TGCCTTCATCACATGTGGGTAGG + Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969370908 4:6731136-6731158 TGCGATCATCAGATGGGGGTGGG + Intergenic
969443996 4:7233820-7233842 TGCAAACATCAGAGGGTGGTGGG + Intronic
974890459 4:67875738-67875760 TGGACTCATAACAAGGAGGTGGG - Intronic
976335823 4:83884984-83885006 TGCAATAATCAAAAGGAGGGTGG - Intergenic
977136685 4:93313810-93313832 TGCAGTTTTCATAAGGGGGTTGG + Intronic
989192160 5:38681208-38681230 TGCAATCAGCACAGGGGTGCGGG + Intergenic
991057865 5:62339293-62339315 TGCACTCATCACCAAGGGGATGG + Intronic
994323676 5:98423586-98423608 TGCCATCTTCAGAAGGGGTTGGG - Intergenic
999074557 5:148781743-148781765 TGCAATCATCCCAGGAGGGAGGG - Intergenic
1008046738 6:46858998-46859020 TGCCAACAACACAGGGGGGTGGG - Exonic
1015994031 6:138979638-138979660 TGCAAGTATTTCAAGGGGGTGGG - Intronic
1016045396 6:139475632-139475654 TGCATAAATCAGAAGGGGGTGGG + Intergenic
1020527707 7:9284139-9284161 TGGCATCATCAAAAGGGGATTGG - Intergenic
1022324910 7:29322387-29322409 TTCCATCATCACAGGGGTGTGGG - Intronic
1023020988 7:36011622-36011644 TGCAGTCATCACACGTGGGCTGG - Intergenic
1025872874 7:65451219-65451241 TGCATTGATTAGAAGGGGGTGGG + Intergenic
1029259128 7:99289504-99289526 TCCTCTCATCACAAGGGGTTTGG - Intergenic
1033862460 7:145644620-145644642 CGCAATGTTCACAAAGGGGTGGG + Intergenic
1039617415 8:38967240-38967262 TGCAATAAACACAAGGGTGCAGG + Intronic
1040744293 8:50620979-50621001 TGCCATCAGAGCAAGGGGGTTGG + Intronic
1045966355 8:108029328-108029350 AGCAATCCTTAGAAGGGGGTTGG - Intronic
1049422820 8:142524428-142524450 GGCCCTCATCACCAGGGGGTGGG + Intronic
1051814279 9:21087250-21087272 TGCTAACATCACAAGGGCCTTGG + Intergenic
1054328699 9:63730946-63730968 TCCAATCCCCACAAGGGGCTGGG - Intergenic
1058648685 9:107154742-107154764 TGAAATCCTCACAAAGGGGCAGG + Intergenic
1058663239 9:107284287-107284309 TGCAATCTACGCAAGGGTGTGGG - Intronic
1058762471 9:108148200-108148222 TTCAATGATCATAAGGGGCTTGG + Intergenic
1203721300 Un_GL000216v2:15340-15362 TGGAATCAACACGAGGGGATTGG - Intergenic
1187247111 X:17562570-17562592 TGCTATAATCACAAAGGGGTGGG + Intronic
1191223736 X:58017658-58017680 TGCAATCAGCACAAGCTGGAGGG - Intergenic
1193494240 X:82190705-82190727 TGTAATAATAACAAGGGGGGCGG + Intergenic
1199767221 X:150950021-150950043 TGCAATCATCAGAAGCAAGTGGG + Intergenic