ID: 1134614755

View in Genome Browser
Species Human (GRCh38)
Location 16:15642781-15642803
Sequence GCGCCGCTGTTCCCCTTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 27}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134614755_1134614758 -1 Left 1134614755 16:15642781-15642803 CCCTCGAAGGGGAACAGCGGCGC 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1134614758 16:15642803-15642825 CCAACAGTGACAGTAGTGAATGG 0: 1
1: 0
2: 2
3: 10
4: 218
1134614755_1134614759 9 Left 1134614755 16:15642781-15642803 CCCTCGAAGGGGAACAGCGGCGC 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1134614759 16:15642813-15642835 CAGTAGTGAATGGACCCGAAAGG 0: 1
1: 0
2: 4
3: 13
4: 332
1134614755_1134614760 10 Left 1134614755 16:15642781-15642803 CCCTCGAAGGGGAACAGCGGCGC 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1134614760 16:15642814-15642836 AGTAGTGAATGGACCCGAAAGGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134614755 Original CRISPR GCGCCGCTGTTCCCCTTCGA GGG (reversed) Intronic