ID: 1134618254

View in Genome Browser
Species Human (GRCh38)
Location 16:15668490-15668512
Sequence CAGGAGGACTGCTCGCGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134618254_1134618260 0 Left 1134618254 16:15668490-15668512 CCTGGACGCGAGCAGTCCTCCTG No data
Right 1134618260 16:15668513-15668535 CCTTGGCCTCCCAAATTGCTGGG 0: 1150
1: 92665
2: 219436
3: 251336
4: 265358
1134618254_1134618266 30 Left 1134618254 16:15668490-15668512 CCTGGACGCGAGCAGTCCTCCTG No data
Right 1134618266 16:15668543-15668565 GCATGAGCCACCACCTGGCCAGG No data
1134618254_1134618265 25 Left 1134618254 16:15668490-15668512 CCTGGACGCGAGCAGTCCTCCTG No data
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data
1134618254_1134618262 8 Left 1134618254 16:15668490-15668512 CCTGGACGCGAGCAGTCCTCCTG No data
Right 1134618262 16:15668521-15668543 TCCCAAATTGCTGGGATTATAGG 0: 385
1: 33600
2: 344762
3: 319397
4: 289577
1134618254_1134618258 -1 Left 1134618254 16:15668490-15668512 CCTGGACGCGAGCAGTCCTCCTG No data
Right 1134618258 16:15668512-15668534 GCCTTGGCCTCCCAAATTGCTGG 0: 696
1: 58431
2: 173956
3: 231690
4: 278447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134618254 Original CRISPR CAGGAGGACTGCTCGCGTCC AGG (reversed) Intronic
No off target data available for this crispr