ID: 1134618256

View in Genome Browser
Species Human (GRCh38)
Location 16:15668506-15668528
Sequence ATTTGGGAGGCCAAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134618256_1134618271 28 Left 1134618256 16:15668506-15668528 CCTCCTGCCTTGGCCTCCCAAAT No data
Right 1134618271 16:15668557-15668579 CTGGCCAGGGAGACATTTTTAGG No data
1134618256_1134618272 29 Left 1134618256 16:15668506-15668528 CCTCCTGCCTTGGCCTCCCAAAT No data
Right 1134618272 16:15668558-15668580 TGGCCAGGGAGACATTTTTAGGG No data
1134618256_1134618267 15 Left 1134618256 16:15668506-15668528 CCTCCTGCCTTGGCCTCCCAAAT No data
Right 1134618267 16:15668544-15668566 CATGAGCCACCACCTGGCCAGGG No data
1134618256_1134618262 -8 Left 1134618256 16:15668506-15668528 CCTCCTGCCTTGGCCTCCCAAAT No data
Right 1134618262 16:15668521-15668543 TCCCAAATTGCTGGGATTATAGG No data
1134618256_1134618266 14 Left 1134618256 16:15668506-15668528 CCTCCTGCCTTGGCCTCCCAAAT No data
Right 1134618266 16:15668543-15668565 GCATGAGCCACCACCTGGCCAGG No data
1134618256_1134618265 9 Left 1134618256 16:15668506-15668528 CCTCCTGCCTTGGCCTCCCAAAT No data
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134618256 Original CRISPR ATTTGGGAGGCCAAGGCAGG AGG (reversed) Intronic