ID: 1134618257

View in Genome Browser
Species Human (GRCh38)
Location 16:15668509-15668531
Sequence GCAATTTGGGAGGCCAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 764728
Summary {0: 725, 1: 62450, 2: 181508, 3: 241157, 4: 278888}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134618257_1134618266 11 Left 1134618257 16:15668509-15668531 CCTGCCTTGGCCTCCCAAATTGC 0: 725
1: 62450
2: 181508
3: 241157
4: 278888
Right 1134618266 16:15668543-15668565 GCATGAGCCACCACCTGGCCAGG No data
1134618257_1134618265 6 Left 1134618257 16:15668509-15668531 CCTGCCTTGGCCTCCCAAATTGC 0: 725
1: 62450
2: 181508
3: 241157
4: 278888
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data
1134618257_1134618271 25 Left 1134618257 16:15668509-15668531 CCTGCCTTGGCCTCCCAAATTGC 0: 725
1: 62450
2: 181508
3: 241157
4: 278888
Right 1134618271 16:15668557-15668579 CTGGCCAGGGAGACATTTTTAGG No data
1134618257_1134618267 12 Left 1134618257 16:15668509-15668531 CCTGCCTTGGCCTCCCAAATTGC 0: 725
1: 62450
2: 181508
3: 241157
4: 278888
Right 1134618267 16:15668544-15668566 CATGAGCCACCACCTGGCCAGGG No data
1134618257_1134618272 26 Left 1134618257 16:15668509-15668531 CCTGCCTTGGCCTCCCAAATTGC 0: 725
1: 62450
2: 181508
3: 241157
4: 278888
Right 1134618272 16:15668558-15668580 TGGCCAGGGAGACATTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134618257 Original CRISPR GCAATTTGGGAGGCCAAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr