ID: 1134618259

View in Genome Browser
Species Human (GRCh38)
Location 16:15668513-15668535
Sequence CCCAGCAATTTGGGAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 813759
Summary {0: 1101, 1: 87148, 2: 211799, 3: 247948, 4: 265763}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134618259_1134618266 7 Left 1134618259 16:15668513-15668535 CCTTGGCCTCCCAAATTGCTGGG 0: 1101
1: 87148
2: 211799
3: 247948
4: 265763
Right 1134618266 16:15668543-15668565 GCATGAGCCACCACCTGGCCAGG No data
1134618259_1134618265 2 Left 1134618259 16:15668513-15668535 CCTTGGCCTCCCAAATTGCTGGG 0: 1101
1: 87148
2: 211799
3: 247948
4: 265763
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data
1134618259_1134618272 22 Left 1134618259 16:15668513-15668535 CCTTGGCCTCCCAAATTGCTGGG 0: 1101
1: 87148
2: 211799
3: 247948
4: 265763
Right 1134618272 16:15668558-15668580 TGGCCAGGGAGACATTTTTAGGG No data
1134618259_1134618274 27 Left 1134618259 16:15668513-15668535 CCTTGGCCTCCCAAATTGCTGGG 0: 1101
1: 87148
2: 211799
3: 247948
4: 265763
Right 1134618274 16:15668563-15668585 AGGGAGACATTTTTAGGGTATGG No data
1134618259_1134618267 8 Left 1134618259 16:15668513-15668535 CCTTGGCCTCCCAAATTGCTGGG 0: 1101
1: 87148
2: 211799
3: 247948
4: 265763
Right 1134618267 16:15668544-15668566 CATGAGCCACCACCTGGCCAGGG No data
1134618259_1134618271 21 Left 1134618259 16:15668513-15668535 CCTTGGCCTCCCAAATTGCTGGG 0: 1101
1: 87148
2: 211799
3: 247948
4: 265763
Right 1134618271 16:15668557-15668579 CTGGCCAGGGAGACATTTTTAGG No data
1134618259_1134618275 30 Left 1134618259 16:15668513-15668535 CCTTGGCCTCCCAAATTGCTGGG 0: 1101
1: 87148
2: 211799
3: 247948
4: 265763
Right 1134618275 16:15668566-15668588 GAGACATTTTTAGGGTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134618259 Original CRISPR CCCAGCAATTTGGGAGGCCA AGG (reversed) Intronic
Too many off-targets to display for this crispr