ID: 1134618261

View in Genome Browser
Species Human (GRCh38)
Location 16:15668519-15668541
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1002480
Summary {0: 345, 1: 32646, 2: 349191, 3: 326783, 4: 293515}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134618261_1134618274 21 Left 1134618261 16:15668519-15668541 CCTCCCAAATTGCTGGGATTATA 0: 345
1: 32646
2: 349191
3: 326783
4: 293515
Right 1134618274 16:15668563-15668585 AGGGAGACATTTTTAGGGTATGG No data
1134618261_1134618272 16 Left 1134618261 16:15668519-15668541 CCTCCCAAATTGCTGGGATTATA 0: 345
1: 32646
2: 349191
3: 326783
4: 293515
Right 1134618272 16:15668558-15668580 TGGCCAGGGAGACATTTTTAGGG No data
1134618261_1134618267 2 Left 1134618261 16:15668519-15668541 CCTCCCAAATTGCTGGGATTATA 0: 345
1: 32646
2: 349191
3: 326783
4: 293515
Right 1134618267 16:15668544-15668566 CATGAGCCACCACCTGGCCAGGG No data
1134618261_1134618265 -4 Left 1134618261 16:15668519-15668541 CCTCCCAAATTGCTGGGATTATA 0: 345
1: 32646
2: 349191
3: 326783
4: 293515
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data
1134618261_1134618271 15 Left 1134618261 16:15668519-15668541 CCTCCCAAATTGCTGGGATTATA 0: 345
1: 32646
2: 349191
3: 326783
4: 293515
Right 1134618271 16:15668557-15668579 CTGGCCAGGGAGACATTTTTAGG No data
1134618261_1134618266 1 Left 1134618261 16:15668519-15668541 CCTCCCAAATTGCTGGGATTATA 0: 345
1: 32646
2: 349191
3: 326783
4: 293515
Right 1134618266 16:15668543-15668565 GCATGAGCCACCACCTGGCCAGG No data
1134618261_1134618275 24 Left 1134618261 16:15668519-15668541 CCTCCCAAATTGCTGGGATTATA 0: 345
1: 32646
2: 349191
3: 326783
4: 293515
Right 1134618275 16:15668566-15668588 GAGACATTTTTAGGGTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134618261 Original CRISPR TATAATCCCAGCAATTTGGG AGG (reversed) Intronic