ID: 1134618262

View in Genome Browser
Species Human (GRCh38)
Location 16:15668521-15668543
Sequence TCCCAAATTGCTGGGATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 987721
Summary {0: 385, 1: 33600, 2: 344762, 3: 319397, 4: 289577}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134618252_1134618262 26 Left 1134618252 16:15668472-15668494 CCAGGCTGGTCTTGAACTCCTGG 0: 17471
1: 86795
2: 157073
3: 181920
4: 169992
Right 1134618262 16:15668521-15668543 TCCCAAATTGCTGGGATTATAGG 0: 385
1: 33600
2: 344762
3: 319397
4: 289577
1134618256_1134618262 -8 Left 1134618256 16:15668506-15668528 CCTCCTGCCTTGGCCTCCCAAAT 0: 437
1: 28558
2: 79961
3: 162520
4: 174890
Right 1134618262 16:15668521-15668543 TCCCAAATTGCTGGGATTATAGG 0: 385
1: 33600
2: 344762
3: 319397
4: 289577
1134618254_1134618262 8 Left 1134618254 16:15668490-15668512 CCTGGACGCGAGCAGTCCTCCTG No data
Right 1134618262 16:15668521-15668543 TCCCAAATTGCTGGGATTATAGG 0: 385
1: 33600
2: 344762
3: 319397
4: 289577
1134618251_1134618262 27 Left 1134618251 16:15668471-15668493 CCCAGGCTGGTCTTGAACTCCTG 0: 17736
1: 36982
2: 56675
3: 51242
4: 33219
Right 1134618262 16:15668521-15668543 TCCCAAATTGCTGGGATTATAGG 0: 385
1: 33600
2: 344762
3: 319397
4: 289577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134618262 Original CRISPR TCCCAAATTGCTGGGATTAT AGG Intronic
Too many off-targets to display for this crispr