ID: 1134618263

View in Genome Browser
Species Human (GRCh38)
Location 16:15668522-15668544
Sequence GCCTATAATCCCAGCAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 981404
Summary {0: 291, 1: 24949, 2: 268587, 3: 336037, 4: 351540}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134618263_1134618267 -1 Left 1134618263 16:15668522-15668544 CCCAAATTGCTGGGATTATAGGC 0: 291
1: 24949
2: 268587
3: 336037
4: 351540
Right 1134618267 16:15668544-15668566 CATGAGCCACCACCTGGCCAGGG No data
1134618263_1134618272 13 Left 1134618263 16:15668522-15668544 CCCAAATTGCTGGGATTATAGGC 0: 291
1: 24949
2: 268587
3: 336037
4: 351540
Right 1134618272 16:15668558-15668580 TGGCCAGGGAGACATTTTTAGGG No data
1134618263_1134618271 12 Left 1134618263 16:15668522-15668544 CCCAAATTGCTGGGATTATAGGC 0: 291
1: 24949
2: 268587
3: 336037
4: 351540
Right 1134618271 16:15668557-15668579 CTGGCCAGGGAGACATTTTTAGG No data
1134618263_1134618265 -7 Left 1134618263 16:15668522-15668544 CCCAAATTGCTGGGATTATAGGC 0: 291
1: 24949
2: 268587
3: 336037
4: 351540
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data
1134618263_1134618275 21 Left 1134618263 16:15668522-15668544 CCCAAATTGCTGGGATTATAGGC 0: 291
1: 24949
2: 268587
3: 336037
4: 351540
Right 1134618275 16:15668566-15668588 GAGACATTTTTAGGGTATGGAGG No data
1134618263_1134618266 -2 Left 1134618263 16:15668522-15668544 CCCAAATTGCTGGGATTATAGGC 0: 291
1: 24949
2: 268587
3: 336037
4: 351540
Right 1134618266 16:15668543-15668565 GCATGAGCCACCACCTGGCCAGG No data
1134618263_1134618274 18 Left 1134618263 16:15668522-15668544 CCCAAATTGCTGGGATTATAGGC 0: 291
1: 24949
2: 268587
3: 336037
4: 351540
Right 1134618274 16:15668563-15668585 AGGGAGACATTTTTAGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134618263 Original CRISPR GCCTATAATCCCAGCAATTT GGG (reversed) Intronic
Too many off-targets to display for this crispr