ID: 1134618264

View in Genome Browser
Species Human (GRCh38)
Location 16:15668523-15668545
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134618264_1134618272 12 Left 1134618264 16:15668523-15668545 CCAAATTGCTGGGATTATAGGCA No data
Right 1134618272 16:15668558-15668580 TGGCCAGGGAGACATTTTTAGGG No data
1134618264_1134618266 -3 Left 1134618264 16:15668523-15668545 CCAAATTGCTGGGATTATAGGCA No data
Right 1134618266 16:15668543-15668565 GCATGAGCCACCACCTGGCCAGG No data
1134618264_1134618275 20 Left 1134618264 16:15668523-15668545 CCAAATTGCTGGGATTATAGGCA No data
Right 1134618275 16:15668566-15668588 GAGACATTTTTAGGGTATGGAGG No data
1134618264_1134618265 -8 Left 1134618264 16:15668523-15668545 CCAAATTGCTGGGATTATAGGCA No data
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data
1134618264_1134618271 11 Left 1134618264 16:15668523-15668545 CCAAATTGCTGGGATTATAGGCA No data
Right 1134618271 16:15668557-15668579 CTGGCCAGGGAGACATTTTTAGG No data
1134618264_1134618274 17 Left 1134618264 16:15668523-15668545 CCAAATTGCTGGGATTATAGGCA No data
Right 1134618274 16:15668563-15668585 AGGGAGACATTTTTAGGGTATGG No data
1134618264_1134618267 -2 Left 1134618264 16:15668523-15668545 CCAAATTGCTGGGATTATAGGCA No data
Right 1134618267 16:15668544-15668566 CATGAGCCACCACCTGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134618264 Original CRISPR TGCCTATAATCCCAGCAATT TGG (reversed) Intronic