ID: 1134618265

View in Genome Browser
Species Human (GRCh38)
Location 16:15668538-15668560
Sequence TATAGGCATGAGCCACCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134618257_1134618265 6 Left 1134618257 16:15668509-15668531 CCTGCCTTGGCCTCCCAAATTGC No data
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data
1134618259_1134618265 2 Left 1134618259 16:15668513-15668535 CCTTGGCCTCCCAAATTGCTGGG No data
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data
1134618254_1134618265 25 Left 1134618254 16:15668490-15668512 CCTGGACGCGAGCAGTCCTCCTG No data
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data
1134618263_1134618265 -7 Left 1134618263 16:15668522-15668544 CCCAAATTGCTGGGATTATAGGC No data
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data
1134618264_1134618265 -8 Left 1134618264 16:15668523-15668545 CCAAATTGCTGGGATTATAGGCA No data
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data
1134618261_1134618265 -4 Left 1134618261 16:15668519-15668541 CCTCCCAAATTGCTGGGATTATA 0: 345
1: 32646
2: 349191
3: 326783
4: 293515
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data
1134618256_1134618265 9 Left 1134618256 16:15668506-15668528 CCTCCTGCCTTGGCCTCCCAAAT No data
Right 1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134618265 Original CRISPR TATAGGCATGAGCCACCACC TGG Intronic