ID: 1134625772

View in Genome Browser
Species Human (GRCh38)
Location 16:15721430-15721452
Sequence GGTCAGCTCCAAGGATGACG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134625772_1134625778 11 Left 1134625772 16:15721430-15721452 CCACGTCATCCTTGGAGCTGACC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1134625778 16:15721464-15721486 TTCGGCTTTGAGCATTTTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 162
1134625772_1134625775 -7 Left 1134625772 16:15721430-15721452 CCACGTCATCCTTGGAGCTGACC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1134625775 16:15721446-15721468 GCTGACCAGGTCTTCCATTTCGG 0: 1
1: 0
2: 1
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134625772 Original CRISPR GGTCAGCTCCAAGGATGACG TGG (reversed) Exonic
904023720 1:27489183-27489205 GGGCTGTTCCAAGGAGGACGTGG - Intronic
904478194 1:30777815-30777837 CCTCAGCTCCAAGGATAACACGG + Intergenic
904705849 1:32390130-32390152 GGTCAGCCCTATGGATGATGGGG + Intronic
905058877 1:35122136-35122158 GTCCAGCTCCAAGGAGGAAGAGG + Intergenic
911666690 1:100561048-100561070 GGTCAGCTCATAGGGTGAAGAGG + Intergenic
918976862 1:191499944-191499966 GCTCAGCTGCAAGGATAACAGGG - Intergenic
920642152 1:207763090-207763112 GGTCAGTTCCTATGATGACCTGG + Intronic
922234363 1:223712348-223712370 GGACAGCTCCCGGGATGGCGCGG - Exonic
922574813 1:226654626-226654648 GGGCAGCTCCAAGGATGGGCTGG - Intronic
923870827 1:237992439-237992461 GGTCAGCTCCCTGGATCACAAGG - Intergenic
924280377 1:242431005-242431027 GGTCAGCTTCAGGGAAGACAAGG - Intronic
1065920970 10:30392589-30392611 GGTCAACTCCAAGGCTGCCCAGG + Intergenic
1070385370 10:75919247-75919269 GGGCAGCTCCAAAGCTGTCGGGG + Intronic
1072633070 10:97160088-97160110 GGCCAGCTCCCAGGGTGACTGGG + Intronic
1072713759 10:97735848-97735870 GGTCATCTGCAAGGAGGACTGGG + Intergenic
1073438319 10:103535833-103535855 GCTTAGCTCCAGGGATGAAGGGG + Intronic
1075086216 10:119415993-119416015 GGACAGTTCCCAGGGTGACGCGG + Intronic
1076898383 10:133325269-133325291 GGGCAGCTCCCAGGAAGCCGTGG - Intronic
1077252647 11:1567387-1567409 GGTCAGCTCCCAGGCCGGCGGGG + Intronic
1080863232 11:36168915-36168937 GTTCAGCTCAAAGCATGATGTGG - Intronic
1088963309 11:114692369-114692391 GCACAGTTCCAAGGATGAAGGGG - Intronic
1089015218 11:115159818-115159840 GGTCAGATCCAAGGAGTAGGAGG - Intergenic
1091154012 11:133356923-133356945 AGTCAGCTCCTAAGATGACAAGG - Intronic
1091305851 11:134535710-134535732 GGTCAGCTCCTAGCATCACAAGG + Intergenic
1098780019 12:74675455-74675477 GGTCAGCTGCAAGGAAGAGTGGG + Intergenic
1101879793 12:108618444-108618466 GGAAAGCTCCCAGGAAGACGAGG + Intergenic
1103733119 12:123041827-123041849 GCTCTGCTCCAGGGATGACAGGG + Intronic
1110515211 13:76403688-76403710 CCTCAGCTCCAAGTATGACTTGG + Intergenic
1113365039 13:109668057-109668079 GGTCAGCTAGAAGGAAGACAAGG + Intergenic
1113666516 13:112145439-112145461 AGTCAGCACCAAGGAGGATGTGG - Intergenic
1113723442 13:112579289-112579311 GGAGAGCTCCAGGGATGCCGTGG - Intronic
1113723452 13:112579335-112579357 GGAGAGCTCCAGGGATGCCGTGG - Intronic
1113723496 13:112579518-112579540 GGAGAGCTCCAGGGATGCCGTGG - Intronic
1113723509 13:112579563-112579585 GGAGAGCTCCAGGGATGCCGTGG - Intronic
1118456078 14:65946696-65946718 GGTCAGCTTCCAGGGTGACCAGG + Intergenic
1119711433 14:76825266-76825288 GATCAGCTCCTAGGATGATCAGG - Intronic
1120850055 14:89161886-89161908 GGTCTGCTCCTAGGGGGACGAGG + Exonic
1121013444 14:90534844-90534866 GGAGAACTCCAAGGATGATGGGG + Exonic
1122055253 14:99093717-99093739 GAGGAGCTCCAAGGATGACAGGG + Intergenic
1123034127 14:105464974-105464996 TGTCAGCACCGAGGAGGACGTGG - Intronic
1123694614 15:22869352-22869374 GGTCACCTCTAAGGCTGAGGTGG - Exonic
1129230056 15:74192117-74192139 GGTCAGCTCAAAGCTTGATGGGG + Intronic
1134625772 16:15721430-15721452 GGTCAGCTCCAAGGATGACGTGG - Exonic
1137545324 16:49398987-49399009 TATCAGCTCCATGGATGACTGGG + Intronic
1141843058 16:86586809-86586831 GCTCTGCACCAAGGATGACCTGG + Intergenic
1143475694 17:7202816-7202838 GGACAGCTACAGGGATGTCGTGG + Intronic
1144369358 17:14575308-14575330 GGGCAGCCCCAGGGAAGACGAGG - Intergenic
1145888845 17:28400638-28400660 GGCCAGCTCCCAGGAGGAAGGGG + Exonic
1146701141 17:34961354-34961376 CGTCAACTCCAAGGCTGAGGTGG - Exonic
1147884552 17:43675981-43676003 GGGCAGCTCCAAGGATGGGCTGG + Intergenic
1151166224 17:72205842-72205864 GATCTGGTCCAAGGATGAGGGGG + Intergenic
1151913290 17:77098736-77098758 GGTGAGCTCCATGAATGAGGTGG - Intronic
1157783216 18:50458402-50458424 GATCAGCTCAAAGGAGGAGGGGG - Intergenic
1161474122 19:4474872-4474894 TGGCAGCTCCAAGGATGCAGAGG - Intronic
1164788853 19:30959193-30959215 GGTCAGCTCCGAGGAGCCCGGGG + Intergenic
1166081740 19:40447966-40447988 GGTCATCTCCAAACATGACCTGG - Exonic
925829772 2:7882742-7882764 GGTCTGCTCCAAGAAAGATGTGG + Intergenic
934196876 2:89844537-89844559 GGGCTGCTCCAGGGATGATGTGG - Intergenic
940286465 2:152037864-152037886 GAGCAGCTCCAAGGATGAGGGGG - Intronic
947603639 2:231469585-231469607 GGGAAGCTCCAAGGAGGATGTGG - Intronic
1170818932 20:19739620-19739642 CATCAGCTCCAAGGAGGACCGGG + Intergenic
1172872878 20:38146873-38146895 GGTCAACTGCAACGATGACCAGG - Exonic
1172995727 20:39069268-39069290 GGTGAGCTCTAAGGAGGAAGAGG - Intergenic
1183185444 22:36289093-36289115 TATGAGCTCCAAGGATGATGTGG - Exonic
1184857609 22:47154971-47154993 CGGCATCTCCAGGGATGACGTGG + Intronic
951708152 3:25564917-25564939 GCTCAGCTCCAAGGCTGCCTGGG - Intronic
953137122 3:40190640-40190662 TGTCATCTCCAAAGAGGACGTGG - Intronic
954573764 3:51663360-51663382 GTTCAGCTCCAATGATGATGAGG + Exonic
961075270 3:123976403-123976425 AGGCAGCTCCCAGGATGATGTGG + Intronic
961308424 3:125976119-125976141 AGGCAGCTCCCAGGATGATGTGG - Intronic
963437348 3:145288585-145288607 GGACAGCTCCAAGGAAGAAAGGG + Intergenic
964849535 3:161080671-161080693 GGTCAGCGCCAATGATGAGCGGG - Intergenic
966585696 3:181621444-181621466 GGTCAGCTAAAAGCATGAAGAGG + Intergenic
967914288 3:194566814-194566836 GCTCAGCCCCAAGGCTGACCTGG - Intergenic
968658369 4:1788367-1788389 GGGCAGCTCCCAGGATGGCGGGG - Intergenic
969892339 4:10271459-10271481 GGTCAACTCAAAGGATTACGGGG + Intergenic
970432374 4:16000901-16000923 GGACAGCTCCAGGGAAGGCGGGG + Intronic
970599252 4:17627887-17627909 GGACAGCTCCAAAGATGTCATGG - Exonic
972113210 4:35592383-35592405 GGTTGGCTCCAAGGAAGACCAGG + Intergenic
974421827 4:61685585-61685607 GGACAGCTCCAAGGATCTTGAGG + Intronic
978782138 4:112567218-112567240 GGTCAGCTCCAAGGAGCTCAGGG - Intronic
979205655 4:118033911-118033933 GGTAATCTCCATGGAGGACGGGG + Intronic
983513595 4:168634326-168634348 GGTCAGCCCCAAAGATGGTGGGG + Intronic
983520841 4:168707392-168707414 GGTCAGCTGCCAGGATGACGAGG + Intronic
987047538 5:14122102-14122124 TGTCAGCTCCAAGGCAGACTTGG + Intergenic
992396516 5:76373823-76373845 GGTCAGCTCTGAGGATCATGGGG + Intergenic
999254438 5:150202247-150202269 TGACAGCTCCAGGGATGGCGTGG - Intronic
1001044901 5:168364270-168364292 GGTCAGCTCCATGGTTAAGGAGG - Intronic
1003322784 6:5066997-5067019 GGCCCGCTCCAAGGATTACCGGG + Intergenic
1006114227 6:31766663-31766685 GGACCCCTCGAAGGATGACGTGG + Exonic
1006304376 6:33210207-33210229 GGTCAGCTCCTAGGATGCTGAGG - Intronic
1006396100 6:33788687-33788709 GGGCAGCTCCGAGGAGGACGAGG - Exonic
1006449878 6:34099693-34099715 GGGCAGCTCCATGGAGGGCGTGG - Intronic
1007934969 6:45724957-45724979 TGTCAGCTCCAAGGAGGAGAGGG - Intergenic
1014703133 6:124714434-124714456 TGTCAGCTCCAAGCATGAAGTGG - Intronic
1016409362 6:143765664-143765686 GGTCAGCTCCAACGCTGACGAGG - Exonic
1016871519 6:148821963-148821985 GAACCGCTCAAAGGATGACGGGG - Intronic
1019409521 7:900493-900515 GGTCAGCTCCAGGGCAGACAGGG - Intronic
1024228236 7:47344754-47344776 AGTCAGCACAAAGGAGGACGTGG - Exonic
1024824781 7:53379048-53379070 CCTCAGCGCCAAGGCTGACGTGG - Intergenic
1025875097 7:65474122-65474144 GGTTACATCCAAGGATGATGTGG + Intergenic
1026446427 7:70488422-70488444 GGACAGCTCCAAGCAGGACTTGG - Intronic
1027236773 7:76303042-76303064 GGTCAAGACCAAGGATGGCGTGG + Exonic
1029548069 7:101221826-101221848 GCTCAGGTCCAAGGAGGAGGAGG + Intronic
1030580391 7:111347662-111347684 GATCAGCTCCAAGGAGGTTGGGG + Intronic
1036533362 8:9619454-9619476 TGTCAGGACCAAGGATGATGGGG + Intronic
1042395646 8:68288973-68288995 GGCAAGCTCCAAGGATTACATGG - Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1049326404 8:142023698-142023720 GGGCACCTCCAAGGGTGGCGAGG - Intergenic
1055280319 9:74666593-74666615 GGTCACCACCATGGATGACCAGG - Intronic
1058881780 9:109291739-109291761 GATCAGTTCCACGGATGACCAGG + Intronic
1062357822 9:136173304-136173326 GGTCAACTCCCAGGATGCAGAGG - Intergenic
1191668244 X:63725128-63725150 GGTCAGTTCCAAGGAGGAGGAGG - Intronic
1197979556 X:132200886-132200908 GGTAAGCACTAAGGATGAAGAGG + Intergenic