ID: 1134629955

View in Genome Browser
Species Human (GRCh38)
Location 16:15749425-15749447
Sequence CTTCCATGTCACCAAGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134629944_1134629955 6 Left 1134629944 16:15749396-15749418 CCCCCTGCTTATCCTAGGCCCCA 0: 1
1: 0
2: 1
3: 9
4: 195
Right 1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG 0: 1
1: 0
2: 1
3: 11
4: 150
1134629941_1134629955 23 Left 1134629941 16:15749379-15749401 CCTCTGCTTATCCTAGGCCCCCT 0: 1
1: 0
2: 1
3: 14
4: 175
Right 1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG 0: 1
1: 0
2: 1
3: 11
4: 150
1134629942_1134629955 12 Left 1134629942 16:15749390-15749412 CCTAGGCCCCCTGCTTATCCTAG 0: 1
1: 0
2: 2
3: 11
4: 159
Right 1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG 0: 1
1: 0
2: 1
3: 11
4: 150
1134629947_1134629955 3 Left 1134629947 16:15749399-15749421 CCTGCTTATCCTAGGCCCCACCC 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG 0: 1
1: 0
2: 1
3: 11
4: 150
1134629940_1134629955 24 Left 1134629940 16:15749378-15749400 CCCTCTGCTTATCCTAGGCCCCC 0: 1
1: 0
2: 2
3: 12
4: 188
Right 1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG 0: 1
1: 0
2: 1
3: 11
4: 150
1134629938_1134629955 30 Left 1134629938 16:15749372-15749394 CCTGGGCCCTCTGCTTATCCTAG 0: 1
1: 0
2: 2
3: 17
4: 180
Right 1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG 0: 1
1: 0
2: 1
3: 11
4: 150
1134629946_1134629955 4 Left 1134629946 16:15749398-15749420 CCCTGCTTATCCTAGGCCCCACC 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG 0: 1
1: 0
2: 1
3: 11
4: 150
1134629945_1134629955 5 Left 1134629945 16:15749397-15749419 CCCCTGCTTATCCTAGGCCCCAC 0: 1
1: 0
2: 1
3: 19
4: 153
Right 1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG 0: 1
1: 0
2: 1
3: 11
4: 150
1134629948_1134629955 -6 Left 1134629948 16:15749408-15749430 CCTAGGCCCCACCCTGCCTTCCA 0: 1
1: 1
2: 6
3: 89
4: 781
Right 1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG 0: 1
1: 0
2: 1
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134629955 Original CRISPR CTTCCATGTCACCAAGTTGA TGG Intronic
900473549 1:2865935-2865957 CTTCCATGTCACCGCGTGGTGGG - Intergenic
900635374 1:3662250-3662272 CTTTCATGTCACCAAGCTGCAGG + Intronic
903300724 1:22376755-22376777 CTCACTTGTCACCAAGTGGATGG - Intergenic
908899085 1:68935080-68935102 CTTCAATGTCACCAAGTAATTGG + Intergenic
909153167 1:72034965-72034987 CTTCCTTGTCACCACGTTTATGG + Intronic
910547081 1:88430764-88430786 ATTGCAGGTCACCAAGTTGGAGG - Intergenic
910984595 1:92993181-92993203 CTTCCATGTCACCCAGTATATGG + Intergenic
911070634 1:93829334-93829356 TTTCCTTGTCACCAGGTTTATGG - Intronic
911097876 1:94070087-94070109 CATCCATGTGCCCAAGTTGTTGG - Intronic
917669720 1:177261965-177261987 CCTCCATGTCACCAAATTGAAGG - Intronic
918199456 1:182253630-182253652 CATACATAACACCAAGTTGAAGG + Intergenic
918875735 1:190040460-190040482 CTCCCAAGTGACTAAGTTGAAGG + Intergenic
919098134 1:193060780-193060802 CCTCCTAGTCTCCAAGTTGAGGG - Intronic
919485768 1:198145495-198145517 CCCCCATGTCACAAAGGTGAAGG + Intergenic
921378573 1:214500495-214500517 CTGTCAGTTCACCAAGTTGAAGG - Intronic
923882632 1:238120152-238120174 CCTCTCTGTCACCAAGTTGCTGG + Intergenic
1063307567 10:4919403-4919425 CTTTCATGTCCCCACATTGATGG + Intergenic
1065598853 10:27347930-27347952 CTGCCGTGTCACACAGTTGAAGG - Intergenic
1066043886 10:31579749-31579771 CTGCCAAGTCACCAAGTCGCTGG - Intergenic
1067058911 10:43067804-43067826 CTTCCAGGCCTCCATGTTGATGG - Intergenic
1069279824 10:66640949-66640971 CTCCCATGTCAAAAAGTTGAGGG - Intronic
1069378870 10:67821881-67821903 CTTCCATGACACCAACTGAATGG + Intronic
1069887567 10:71633699-71633721 GTTCCAGGACACCAAGTTTATGG + Intronic
1073004422 10:100311749-100311771 ATTCTTTGTCAACAAGTTGAGGG - Intronic
1076990500 11:271061-271083 CTTCCATGTCACCACCCTGATGG + Intergenic
1078906299 11:15691217-15691239 ATTCTAAGTCACCAAGTTTATGG - Intergenic
1080481987 11:32661150-32661172 CTAGCATGTCACCACCTTGAAGG - Intronic
1080768512 11:35318792-35318814 CATCCTTGTCATGAAGTTGATGG - Intronic
1088607675 11:111547064-111547086 ATTCCATGTCACCTGGTTTATGG + Intronic
1089038838 11:115426374-115426396 CTTCCATGTCACCCAGAGTAGGG + Intronic
1090515908 11:127426558-127426580 CTACCATATAACCAAGTTCAAGG + Intergenic
1090534337 11:127624302-127624324 CCTCCAGGTCACCAAGGAGAGGG - Intergenic
1091042157 11:132291821-132291843 CTTCCATGTGTCCAAATTCATGG - Intronic
1091051173 11:132374010-132374032 CTTCCATCTCCTCAAGTGGAGGG - Intergenic
1094322076 12:29195411-29195433 CTTCCATGTCACCATTTAAAAGG + Intronic
1099575719 12:84378589-84378611 ATTCCCTATTACCAAGTTGAGGG + Intergenic
1101196622 12:102389989-102390011 CTTCAATGTAATCAATTTGAAGG - Intergenic
1101542200 12:105675462-105675484 TTTCCATGGAACCAAGTTTATGG + Intergenic
1102986295 12:117281089-117281111 CTCCCATGCCACCATGCTGAAGG + Intronic
1104442600 12:128806734-128806756 CTTCCATGTCACCAATTCAGAGG + Intronic
1104513579 12:129403633-129403655 CTTCCCTGGCACAAAGTAGAGGG - Intronic
1105310766 13:19207991-19208013 CTTCCATCTTACCAAGTAGCGGG - Intergenic
1105360436 13:19709047-19709069 CTTCCATCTTACCAAGTAGCTGG - Intronic
1105377471 13:19858892-19858914 CTTCCCTCCCATCAAGTTGATGG + Intronic
1105615983 13:22012858-22012880 CTTCCATGTCACCAGGAAGTGGG - Intergenic
1105877166 13:24567366-24567388 CTTCCATCTTACCAAGTAGCTGG + Intergenic
1108249667 13:48551656-48551678 CTTCCCTCTCACCATGTTGTGGG + Intergenic
1108265820 13:48707620-48707642 TTTCCATGTCGTCAAGTGGACGG - Exonic
1108578288 13:51807654-51807676 TCTCCATGTAGCCAAGTTGATGG + Intergenic
1111009821 13:82296909-82296931 TTTCCACCTCGCCAAGTTGAAGG - Intergenic
1113028413 13:105967061-105967083 CTTACATGTCACCAGGTGGCTGG - Intergenic
1113154031 13:107297440-107297462 CTTCCATTTCTACAAGTTAAAGG + Intronic
1113915072 13:113865401-113865423 CTTCCATGTCAGCTAGTTACTGG + Intergenic
1120149651 14:81019128-81019150 GTTGCATGCCACCAATTTGAAGG - Intronic
1122722846 14:103731819-103731841 CTCCCAAGTCATCAAGTTCATGG + Intronic
1124344360 15:28912225-28912247 CTTACATGTCACAAAATGGATGG - Intronic
1125067101 15:35500562-35500584 CTTTCATGTCAACAAGTATATGG - Intronic
1126189857 15:45868005-45868027 CTTTCAAGTCACCAAGTATATGG - Intergenic
1131868683 15:96738904-96738926 CTTCCATGTCCACAGGTTCAGGG + Intergenic
1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG + Intronic
1134661173 16:15985772-15985794 GTTCTCAGTCACCAAGTTGATGG - Intronic
1137441076 16:48498828-48498850 CTTCCAGGACACTAAGTTCATGG + Intergenic
1143718167 17:8790379-8790401 CTTCCTTGAAACCAAGTCGAGGG + Intergenic
1144598078 17:16588537-16588559 CTGCCCTGTCACATAGTTGAAGG - Intergenic
1144668949 17:17120641-17120663 CTGCTATGTCACCAAGTTATGGG - Intronic
1148619823 17:49026188-49026210 CTGCCATATTACCAAGTTTAGGG - Intronic
1153730888 18:8010648-8010670 CCTCCATCTCACCAAGTCCATGG - Intronic
1154094100 18:11394331-11394353 CTTCCATGTCAAAATGTCGAAGG + Intergenic
1157848601 18:51027175-51027197 CTGCCCTGTCACATAGTTGAAGG + Intronic
1160392272 18:78543164-78543186 TTTCCATGTTACCATGTGGATGG - Intergenic
1160434789 18:78841486-78841508 CCTCCACGTCACCTAGTTGCTGG - Intergenic
1162458903 19:10802826-10802848 CTTCCGTGGCACCCAGATGAGGG + Intronic
1168357654 19:55712583-55712605 CTTCCACCTCCCCAGGTTGATGG - Exonic
927112415 2:19873203-19873225 TTGGCATGTGACCAAGTTGATGG + Intergenic
927812587 2:26188188-26188210 CTTCCACCTCACCAAGCTGCAGG + Exonic
929959282 2:46484324-46484346 CATCTATGTCACCAAGGAGATGG + Exonic
931265005 2:60652793-60652815 ATTCTAAGTCACCAAGTTTATGG + Intergenic
931668092 2:64624560-64624582 CTTCCCTGTAGCCAAGCTGAGGG + Intergenic
932707398 2:74037353-74037375 CTTCCTTGCCACCAAATGGATGG - Intronic
936936701 2:117846129-117846151 CTTCCATGCTAACAAGTTCAAGG + Intergenic
937389565 2:121472517-121472539 TTTCCAGGTCACCAAGTACAGGG + Intronic
943048515 2:182887726-182887748 GTTTCATTTCACCAAGTTGTAGG + Intergenic
944037733 2:195316241-195316263 CTTTCATGTCAATAGGTTGAGGG + Intergenic
946284692 2:218694137-218694159 CCTCCAAGGCACAAAGTTGATGG - Intronic
946677837 2:222181284-222181306 TCTCTCTGTCACCAAGTTGAAGG - Intergenic
948921443 2:241067783-241067805 CTTCGAGGTCACCAATGTGACGG + Exonic
1170489779 20:16861396-16861418 ATTCCATGTCACCTAGTAAACGG - Intergenic
1172335240 20:34110654-34110676 CCTCCAAGTCACTACGTTGATGG + Intronic
1175075371 20:56367818-56367840 CTGCCCTGTCACGTAGTTGAAGG + Exonic
1175566708 20:59985521-59985543 CTTCCTTATCACCAAGGGGATGG + Intronic
1182445186 22:30385917-30385939 CTCCAATGTCACCAAGCTGTTGG - Exonic
1182766440 22:32761234-32761256 TTTCCATATTGCCAAGTTGAGGG + Intronic
1184622350 22:45690925-45690947 CTTCCCTGTCACCACTGTGACGG + Intronic
1184880454 22:47300961-47300983 CTTCCATGTGGCCCAGATGAGGG - Intergenic
949241388 3:1876598-1876620 ATTCCCAGTCACCAAGTTTATGG + Intergenic
949788162 3:7764258-7764280 CTTTCATGTCACCAAGTTTCTGG + Intergenic
949929759 3:9069453-9069475 CTTCCCTGGCATCAAGTGGATGG - Intronic
950397411 3:12744293-12744315 CTTCCATCCCACCAAGTGCAGGG + Intronic
952825306 3:37519814-37519836 CTTCCATGTTCCCAAGTATAGGG - Intronic
953792477 3:45958865-45958887 CTTCCCTGGCACCAAGTTGTAGG + Intronic
954575746 3:51675082-51675104 ATGCCATATCACCAGGTTGAGGG - Intronic
955034210 3:55250572-55250594 CCTGCAAGTCACCATGTTGAAGG - Intergenic
960998713 3:123357879-123357901 CTTCCTTGTCCCCAAGGTGTGGG - Intronic
961974938 3:131013805-131013827 GTTCCATTTCAGCAAGTTAATGG - Intronic
965456532 3:168908316-168908338 CTTCACAGTCACAAAGTTGATGG - Intergenic
965550555 3:169960920-169960942 CTTCCATCTCAGCAAGTGGAAGG - Intergenic
968438643 4:609997-610019 CTACCCTGTCACCACTTTGAGGG - Intergenic
968548323 4:1209918-1209940 TTTCCATGTTTCCAAGTTGAAGG - Intergenic
969181573 4:5446087-5446109 CTTCCCTTTCGCCAAGTGGACGG + Intronic
969543302 4:7807554-7807576 CTGCCATTTGACCAAGTTCAGGG + Intronic
970258672 4:14199187-14199209 CTTTCAAGTCACCCAGTTTATGG + Intergenic
979397613 4:120207318-120207340 CTTCCATTTCACTAAGTCCAAGG - Intergenic
980210825 4:129785023-129785045 TTACTATGTCCCCAAGTTGATGG - Intergenic
981841725 4:149120767-149120789 CTTCCATGTGAACAAGGGGAAGG + Intergenic
986026183 5:3853564-3853586 CCTCCATGTCACCAACATGCTGG + Intergenic
986157944 5:5195719-5195741 CTTGCATTTCCCCAAGTTTATGG + Intronic
987451057 5:18084561-18084583 ACTCCATGTCACCAAGTAAATGG - Intergenic
988758371 5:34285484-34285506 CTTCCCTGTCCCCAAGGTCAAGG + Intergenic
990263495 5:54050090-54050112 CTTCGTTGTCACATAGTTGAAGG - Intronic
990861331 5:60331069-60331091 ATTGCATGTCACCAAGTGCAAGG + Intronic
994194958 5:96912225-96912247 CTTTTTTATCACCAAGTTGAAGG - Intronic
994994116 5:107037609-107037631 ATTCCATGGCTCCATGTTGATGG - Intergenic
995902660 5:117088511-117088533 TTTCCATGTCAACAATTTAAAGG - Intergenic
998411499 5:141914676-141914698 CTTCAAGGTCACATAGTTGACGG - Intergenic
998707362 5:144778466-144778488 CTTCCAAGTCTCCAACTTTAAGG - Intergenic
1000202811 5:159028287-159028309 CTTCCTTGTCACCAAGTTCCTGG - Intronic
1000923815 5:167169767-167169789 ATTCCATGGCACCAAGAGGAAGG - Intergenic
1003461670 6:6334540-6334562 CTTCCAAGTCCCCAGGTAGAGGG + Intergenic
1004487630 6:16082317-16082339 CTTCTATGTCACCAAGCAGGTGG + Intergenic
1005070859 6:21861166-21861188 CATCCATGACACCAGGCTGAAGG - Intergenic
1007144775 6:39617412-39617434 GTTCCTTTTCAGCAAGTTGATGG - Intronic
1007204447 6:40137143-40137165 ATTCCATGTCTCCAAATTGGAGG + Intergenic
1008333039 6:50265335-50265357 ATTCCTTCTCACCAAGCTGATGG + Intergenic
1014125277 6:117769977-117769999 CCTCCCTGTCTCCAAGATGAAGG - Intergenic
1014248672 6:119094260-119094282 CTTCCATGACAGCAAGTAAAGGG - Intronic
1021640281 7:22729678-22729700 CTTCCCCCACACCAAGTTGAGGG - Intronic
1028116177 7:87000499-87000521 CTGCAATGTCACCAATTTGCTGG + Intronic
1031069981 7:117151484-117151506 CTTCCATGATACCCAGTTGAAGG + Intronic
1031116668 7:117676264-117676286 CTTCTATCACACCAAGTTGGGGG + Intronic
1033590560 7:142804948-142804970 TTTCCACGTCCCCAAGATGATGG - Intergenic
1033867498 7:145710306-145710328 CTTAGTTGTCAGCAAGTTGAGGG - Intergenic
1034252126 7:149701149-149701171 CTTCCAGCTCACCAGGTTGCAGG - Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037606532 8:20442395-20442417 CTTCCATGTTACCAAATCCAGGG - Intergenic
1038789682 8:30657698-30657720 CTTCCAAGCCTCCAAGTTCACGG - Intronic
1039101512 8:33946825-33946847 GTACCATGTCCCCAAGTTGTAGG + Intergenic
1041862066 8:62525737-62525759 CTTTCATGTAACGAAGTTGGGGG - Intronic
1044448102 8:92302015-92302037 CTCCCATTTCACCAAAATGAAGG - Intergenic
1045517347 8:102871747-102871769 CTTCCAAGTCACTCAGATGAGGG - Intronic
1049259199 8:141629699-141629721 CTGCCCTGTCTCCAGGTTGAGGG + Intergenic
1049312436 8:141940328-141940350 CTTTCATGTCACTAAGTTTTGGG + Intergenic
1057953031 9:99385165-99385187 CTTCCATGGCAGTAAGATGAGGG + Intergenic
1059559789 9:115323130-115323152 CTTTTATGACACAAAGTTGAGGG + Intronic
1060253471 9:122004771-122004793 TTTCCATGACACCACGTTGGCGG + Intronic
1188897084 X:35682456-35682478 CTACTATGTCACCAAATTTAAGG - Intergenic
1191273285 X:58508187-58508209 CATTCATCTCACAAAGTTGAAGG + Intergenic
1191801956 X:65091416-65091438 GTTTCATGCCACCAAGTTTATGG + Intergenic
1194387587 X:93276489-93276511 CTTCCCTGTCACCAATGTGGTGG + Intergenic
1197794883 X:130288018-130288040 CTTGAATGTAACCAATTTGAAGG - Intergenic
1198048769 X:132928455-132928477 CTCCCTTATCACCAAGTGGATGG + Intronic
1198111377 X:133505412-133505434 CTCACTTGTCACCAAGTGGATGG + Intergenic
1199190342 X:144963130-144963152 CTTCCATCTCACCAGGAAGACGG + Intergenic
1201938039 Y:19428489-19428511 TTTCCTTGTCACCATGTTTATGG - Intergenic