ID: 1134630735

View in Genome Browser
Species Human (GRCh38)
Location 16:15753960-15753982
Sequence CTGTGGAAGGCCAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265827
Summary {0: 8, 1: 1133, 2: 25627, 3: 79568, 4: 159491}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134630726_1134630735 11 Left 1134630726 16:15753926-15753948 CCAAGCGTGGTGGTTCACACTGG No data
Right 1134630735 16:15753960-15753982 CTGTGGAAGGCCAAGGTGGGTGG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134630735 Original CRISPR CTGTGGAAGGCCAAGGTGGG TGG Intronic
Too many off-targets to display for this crispr