ID: 1134631280

View in Genome Browser
Species Human (GRCh38)
Location 16:15757838-15757860
Sequence TGAGCTCGATGCAGGGCTGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 121}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134631273_1134631280 3 Left 1134631273 16:15757812-15757834 CCACGTGCCCCTCACCGGTCGCT 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1134631280 16:15757838-15757860 TGAGCTCGATGCAGGGCTGTAGG 0: 1
1: 0
2: 3
3: 15
4: 121
1134631269_1134631280 12 Left 1134631269 16:15757803-15757825 CCCGCACGCCCACGTGCCCCTCA 0: 1
1: 0
2: 1
3: 26
4: 203
Right 1134631280 16:15757838-15757860 TGAGCTCGATGCAGGGCTGTAGG 0: 1
1: 0
2: 3
3: 15
4: 121
1134631274_1134631280 -4 Left 1134631274 16:15757819-15757841 CCCCTCACCGGTCGCTCGATGAG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1134631280 16:15757838-15757860 TGAGCTCGATGCAGGGCTGTAGG 0: 1
1: 0
2: 3
3: 15
4: 121
1134631268_1134631280 13 Left 1134631268 16:15757802-15757824 CCCCGCACGCCCACGTGCCCCTC 0: 1
1: 0
2: 1
3: 22
4: 302
Right 1134631280 16:15757838-15757860 TGAGCTCGATGCAGGGCTGTAGG 0: 1
1: 0
2: 3
3: 15
4: 121
1134631276_1134631280 -6 Left 1134631276 16:15757821-15757843 CCTCACCGGTCGCTCGATGAGCT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1134631280 16:15757838-15757860 TGAGCTCGATGCAGGGCTGTAGG 0: 1
1: 0
2: 3
3: 15
4: 121
1134631272_1134631280 4 Left 1134631272 16:15757811-15757833 CCCACGTGCCCCTCACCGGTCGC 0: 1
1: 0
2: 1
3: 4
4: 57
Right 1134631280 16:15757838-15757860 TGAGCTCGATGCAGGGCTGTAGG 0: 1
1: 0
2: 3
3: 15
4: 121
1134631275_1134631280 -5 Left 1134631275 16:15757820-15757842 CCCTCACCGGTCGCTCGATGAGC 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1134631280 16:15757838-15757860 TGAGCTCGATGCAGGGCTGTAGG 0: 1
1: 0
2: 3
3: 15
4: 121
1134631270_1134631280 11 Left 1134631270 16:15757804-15757826 CCGCACGCCCACGTGCCCCTCAC 0: 1
1: 0
2: 2
3: 27
4: 321
Right 1134631280 16:15757838-15757860 TGAGCTCGATGCAGGGCTGTAGG 0: 1
1: 0
2: 3
3: 15
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134631280 Original CRISPR TGAGCTCGATGCAGGGCTGT AGG Exonic