ID: 1134634009

View in Genome Browser
Species Human (GRCh38)
Location 16:15778594-15778616
Sequence ACATGTGTGGACCGGACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134634009_1134634018 25 Left 1134634009 16:15778594-15778616 CCAGGGGTCCGGTCCACACATGT 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1134634018 16:15778642-15778664 TGTTAAGGGGAGATTTGTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
1134634009_1134634016 12 Left 1134634009 16:15778594-15778616 CCAGGGGTCCGGTCCACACATGT 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1134634016 16:15778629-15778651 CCACAATGCCTGCTGTTAAGGGG 0: 1
1: 0
2: 1
3: 16
4: 150
1134634009_1134634013 10 Left 1134634009 16:15778594-15778616 CCAGGGGTCCGGTCCACACATGT 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1134634013 16:15778627-15778649 CACCACAATGCCTGCTGTTAAGG 0: 1
1: 0
2: 1
3: 6
4: 132
1134634009_1134634014 11 Left 1134634009 16:15778594-15778616 CCAGGGGTCCGGTCCACACATGT 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1134634014 16:15778628-15778650 ACCACAATGCCTGCTGTTAAGGG 0: 1
1: 0
2: 1
3: 14
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134634009 Original CRISPR ACATGTGTGGACCGGACCCC TGG (reversed) Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
900953885 1:5875115-5875137 ACATGGGTGGACAGGGTCCCAGG + Intronic
902074169 1:13769420-13769442 GTATGTGTGGGCAGGACCCCTGG + Intronic
903968944 1:27106705-27106727 ACACGTGGGGACCAGGCCCCAGG - Intronic
909467484 1:75989301-75989323 AAATGTGTGGACCGGAGCTCAGG - Intergenic
1062836440 10:639164-639186 ACATGTGTGGACCGGGAGCCGGG - Intronic
1063611728 10:7568569-7568591 ACATGTGTTGAAGGAACCCCAGG + Intronic
1063708973 10:8458656-8458678 ACAGGTGTGCACCAGACGCCTGG + Intergenic
1065164927 10:22966445-22966467 ACATGCGTGGAGAAGACCCCAGG - Intronic
1067752846 10:48983347-48983369 CCAAGTGTGGACCGGGGCCCTGG - Intergenic
1072319213 10:94232664-94232686 GCCTGTGAGGACAGGACCCCAGG - Intronic
1072434546 10:95403282-95403304 ACCTGTGGGGACGGGACTCCAGG - Intronic
1073006268 10:100327435-100327457 ACATGAGTGGATTGGACTCCTGG + Intronic
1076605843 10:131689404-131689426 ACATGTGTAGAGAGGACGCCAGG - Intergenic
1077373895 11:2196143-2196165 ACCTGTGTGGTCCAGAACCCAGG - Intergenic
1083161995 11:60860045-60860067 ACATGTGTGGGCCTGAGCCCAGG - Intergenic
1084582301 11:70031736-70031758 ACAGGTGTTGACCGGGCACCAGG + Intergenic
1088659447 11:112030893-112030915 ACATGTGTGAACTGAACACCTGG - Intronic
1090144032 11:124299861-124299883 GCATGTGTGGAACAGACCCAAGG - Intergenic
1090924439 11:131237044-131237066 ACCTGTGTGCACCGGGGCCCAGG + Intergenic
1094511051 12:31096806-31096828 TCATGTGTGGACCTGACCAGAGG + Intronic
1107576634 13:41731196-41731218 ACCTCTGTGGTCCAGACCCCAGG - Intronic
1107631253 13:42344764-42344786 ACATGTCAGGGCCGGACCTCAGG + Intergenic
1110120047 13:71868527-71868549 ACATGTGTGGACCGGTTCAAAGG - Intergenic
1114764509 14:25355858-25355880 ACAAGTCTGGACAAGACCCCAGG + Intergenic
1115191687 14:30753503-30753525 ACATGTGTGAACAGAATCCCTGG + Intergenic
1119652390 14:76392939-76392961 ACATGTGTGAGCTGGAACCCAGG + Intronic
1124353741 15:28979307-28979329 ACAGGAGTGGACCGGGACCCGGG - Intronic
1127405434 15:58640007-58640029 AGATGAGTGGAAAGGACCCCAGG - Intronic
1129786307 15:78312530-78312552 ACTTGTGCAGAACGGACCCCAGG - Intergenic
1134634009 16:15778594-15778616 ACATGTGTGGACCGGACCCCTGG - Intronic
1139523275 16:67497504-67497526 CCATCTGTGGCCTGGACCCCAGG + Intergenic
1141996827 16:87641199-87641221 ATGTATGTGGACCGGACCCCAGG - Intronic
1147948865 17:44095923-44095945 CCATGTGGGGACTGGACCCAAGG - Intronic
1149681167 17:58508316-58508338 ACATGTGATGACAGGATCCCTGG + Intronic
1150246137 17:63676769-63676791 ACAGGTGTGGACCAGACCTGAGG - Intronic
1151899375 17:77001822-77001844 ACAAGTGTAGACCGAACCCCGGG + Intergenic
1154106760 18:11530514-11530536 TCCTGTGTGGACCAGACGCCAGG - Intergenic
1161334959 19:3708138-3708160 ACATGAATGGACCGCACTCCCGG - Intronic
1164250998 19:23475456-23475478 ACATGTGTGGACAGAAGACCTGG - Intergenic
1164494683 19:28749328-28749350 ACATGTGTGGGAGGGACCCAGGG - Intergenic
1168201273 19:54817547-54817569 CCATGTGTGGACCGGCCCTCTGG - Exonic
929249371 2:39735862-39735884 ACATGGGTGGACCTGATACCAGG + Intergenic
933709846 2:85316834-85316856 CCATCTGTGGACAGAACCCCTGG + Intergenic
936972881 2:118191783-118191805 AGAAGTGTGGACAGGATCCCAGG + Intergenic
941848756 2:170158450-170158472 CCAAGGGTGGACCGGATCCCTGG - Intergenic
942525934 2:176852951-176852973 ACAGGTGTGTACCTGACCCCCGG + Intergenic
945132458 2:206588069-206588091 ACATGTGTGCTCCTGTCCCCAGG + Exonic
948481987 2:238255927-238255949 GCACGTGTGGACCAGAGCCCTGG - Intronic
1169278096 20:4246972-4246994 CCATGGGTGGATCTGACCCCGGG + Intronic
1175790774 20:61738615-61738637 TGATGTGTGAACTGGACCCCAGG - Intronic
1182123267 22:27800172-27800194 ACTTCGGTGGCCCGGACCCCGGG - Exonic
1182166426 22:28178872-28178894 ACATATGTGGATCTGAACCCTGG - Intronic
1182223181 22:28774635-28774657 ACAGGTGTGAACCGTCCCCCAGG + Intronic
1185064251 22:48622836-48622858 ACAGGTGTGAACAGGTCCCCTGG + Intronic
954419508 3:50411180-50411202 ACATTTGAGGAGCGGTCCCCTGG - Intronic
968979850 4:3841377-3841399 TCATGTGTGCACAGGCCCCCAGG + Intergenic
969251184 4:5969905-5969927 CCATCTGTGGAGTGGACCCCAGG + Intronic
974121695 4:57646081-57646103 ACATCTGTGGACTGGACCCATGG - Intergenic
975327475 4:73076272-73076294 ATAGGTGTGGACTGGACCCTGGG - Exonic
975512666 4:75210926-75210948 CCCTGTGTGGACAGGACCCATGG - Intergenic
982333472 4:154208486-154208508 ACATGTCTGGCCCTGACCACAGG - Intergenic
985773957 5:1830869-1830891 ATATGTGTGGACCTGACTTCTGG + Intergenic
986014500 5:3746278-3746300 ATGTGTGTGGACCGGACCCAAGG + Intergenic
986644142 5:9899889-9899911 TCATTTGGGGACCGGACCACAGG - Intergenic
995261556 5:110110024-110110046 ATATGTGTGTACCAGACCTCAGG + Intergenic
996917230 5:128726320-128726342 ACATGTGTGGAAAGGACCCGGGG - Intronic
1007345755 6:41228432-41228454 GCAGGTGTGGACCCCACCCCAGG - Exonic
1008708006 6:54186874-54186896 ACATGTGTGCATCAGACCCTAGG + Intronic
1015312614 6:131782087-131782109 AGATATGGGGCCCGGACCCCTGG - Intergenic
1017520641 6:155198850-155198872 ACATGTGTGGAGGGCACCCTGGG + Intronic
1020490044 7:8770753-8770775 AAATGTGTTGACTGGACTCCAGG + Intergenic
1024191363 7:47014594-47014616 ACAGTTGTGGGCAGGACCCCTGG + Intergenic
1034757965 7:153640809-153640831 ACATGTGATGACCAGGCCCCAGG + Intergenic
1034887700 7:154810702-154810724 ACATGACTGACCCGGACCCCAGG + Intronic
1035255058 7:157620888-157620910 ACCTGTGTGTACCAGTCCCCGGG - Intronic
1040530713 8:48264245-48264267 AGACATGTGGACCGGAACCCTGG + Intergenic
1041084892 8:54247688-54247710 ACCTGGGTGGACCGGACCATGGG + Intergenic
1043472909 8:80578979-80579001 ACCTCTGTGGGCAGGACCCCTGG + Intergenic
1047696262 8:127406370-127406392 CCAAGTGTGAACAGGACCCCAGG + Intergenic
1059360252 9:113736583-113736605 ACATATGTGGACCAGAACCCGGG - Intergenic
1061028022 9:128063148-128063170 ACATGTGTTGTCATGACCCCGGG - Exonic
1062065373 9:134523816-134523838 TCACATGTGGACCGGATCCCAGG - Intergenic
1062065459 9:134524136-134524158 TCACATGTGGACCGGATCCCAGG - Intergenic
1062065530 9:134524396-134524418 TCACATGTGGACCGGATCCCAGG - Intergenic
1062065601 9:134524656-134524678 TCACATGTGGACCGGATCCCAGG - Intergenic
1062386871 9:136315935-136315957 ACATGTGTGGAGGGGGCCACTGG + Intergenic
1190971786 X:55356818-55356840 AGATGTGTGGTCTGGACCCAGGG + Intergenic
1198281606 X:135148283-135148305 ACATGTGTGGCAGGGAGCCCAGG + Intergenic
1198289353 X:135224239-135224261 ACATGTGTGGCAGGGAGCCCAGG - Intergenic
1200139577 X:153892664-153892686 AGATATGTGGACAGGAACCCAGG + Intronic