ID: 1134634013

View in Genome Browser
Species Human (GRCh38)
Location 16:15778627-15778649
Sequence CACCACAATGCCTGCTGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134634011_1134634013 -3 Left 1134634011 16:15778607-15778629 CCACACATGTATAACCACTGCAC 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1134634013 16:15778627-15778649 CACCACAATGCCTGCTGTTAAGG 0: 1
1: 0
2: 1
3: 6
4: 132
1134634010_1134634013 2 Left 1134634010 16:15778602-15778624 CCGGTCCACACATGTATAACCAC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1134634013 16:15778627-15778649 CACCACAATGCCTGCTGTTAAGG 0: 1
1: 0
2: 1
3: 6
4: 132
1134634009_1134634013 10 Left 1134634009 16:15778594-15778616 CCAGGGGTCCGGTCCACACATGT 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1134634013 16:15778627-15778649 CACCACAATGCCTGCTGTTAAGG 0: 1
1: 0
2: 1
3: 6
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134634013 Original CRISPR CACCACAATGCCTGCTGTTA AGG Intronic