ID: 1134634016

View in Genome Browser
Species Human (GRCh38)
Location 16:15778629-15778651
Sequence CCACAATGCCTGCTGTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134634011_1134634016 -1 Left 1134634011 16:15778607-15778629 CCACACATGTATAACCACTGCAC 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1134634016 16:15778629-15778651 CCACAATGCCTGCTGTTAAGGGG 0: 1
1: 0
2: 1
3: 16
4: 150
1134634009_1134634016 12 Left 1134634009 16:15778594-15778616 CCAGGGGTCCGGTCCACACATGT 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1134634016 16:15778629-15778651 CCACAATGCCTGCTGTTAAGGGG 0: 1
1: 0
2: 1
3: 16
4: 150
1134634010_1134634016 4 Left 1134634010 16:15778602-15778624 CCGGTCCACACATGTATAACCAC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1134634016 16:15778629-15778651 CCACAATGCCTGCTGTTAAGGGG 0: 1
1: 0
2: 1
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134634016 Original CRISPR CCACAATGCCTGCTGTTAAG GGG Intronic