ID: 1134634018

View in Genome Browser
Species Human (GRCh38)
Location 16:15778642-15778664
Sequence TGTTAAGGGGAGATTTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134634010_1134634018 17 Left 1134634010 16:15778602-15778624 CCGGTCCACACATGTATAACCAC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1134634018 16:15778642-15778664 TGTTAAGGGGAGATTTGTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
1134634012_1134634018 -2 Left 1134634012 16:15778621-15778643 CCACTGCACCACAATGCCTGCTG 0: 1
1: 0
2: 10
3: 22
4: 318
Right 1134634018 16:15778642-15778664 TGTTAAGGGGAGATTTGTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
1134634009_1134634018 25 Left 1134634009 16:15778594-15778616 CCAGGGGTCCGGTCCACACATGT 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1134634018 16:15778642-15778664 TGTTAAGGGGAGATTTGTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
1134634011_1134634018 12 Left 1134634011 16:15778607-15778629 CCACACATGTATAACCACTGCAC 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1134634018 16:15778642-15778664 TGTTAAGGGGAGATTTGTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
1134634015_1134634018 -10 Left 1134634015 16:15778629-15778651 CCACAATGCCTGCTGTTAAGGGG 0: 1
1: 0
2: 2
3: 12
4: 114
Right 1134634018 16:15778642-15778664 TGTTAAGGGGAGATTTGTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134634018 Original CRISPR TGTTAAGGGGAGATTTGTTC TGG Intronic