ID: 1134640517

View in Genome Browser
Species Human (GRCh38)
Location 16:15826252-15826274
Sequence CTTGACTAAAAGGCCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134640517_1134640524 1 Left 1134640517 16:15826252-15826274 CCCTCAAGGGCCTTTTAGTCAAG No data
Right 1134640524 16:15826276-15826298 GCTGGAGCCAATTAGAGAGTGGG No data
1134640517_1134640529 20 Left 1134640517 16:15826252-15826274 CCCTCAAGGGCCTTTTAGTCAAG No data
Right 1134640529 16:15826295-15826317 TGGGAAAGTCTGGCTGGGTGTGG No data
1134640517_1134640527 14 Left 1134640517 16:15826252-15826274 CCCTCAAGGGCCTTTTAGTCAAG No data
Right 1134640527 16:15826289-15826311 AGAGAGTGGGAAAGTCTGGCTGG No data
1134640517_1134640526 10 Left 1134640517 16:15826252-15826274 CCCTCAAGGGCCTTTTAGTCAAG No data
Right 1134640526 16:15826285-15826307 AATTAGAGAGTGGGAAAGTCTGG No data
1134640517_1134640528 15 Left 1134640517 16:15826252-15826274 CCCTCAAGGGCCTTTTAGTCAAG No data
Right 1134640528 16:15826290-15826312 GAGAGTGGGAAAGTCTGGCTGGG No data
1134640517_1134640530 23 Left 1134640517 16:15826252-15826274 CCCTCAAGGGCCTTTTAGTCAAG No data
Right 1134640530 16:15826298-15826320 GAAAGTCTGGCTGGGTGTGGTGG No data
1134640517_1134640523 0 Left 1134640517 16:15826252-15826274 CCCTCAAGGGCCTTTTAGTCAAG No data
Right 1134640523 16:15826275-15826297 GGCTGGAGCCAATTAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134640517 Original CRISPR CTTGACTAAAAGGCCCTTGA GGG (reversed) Intronic
No off target data available for this crispr