ID: 1134641393

View in Genome Browser
Species Human (GRCh38)
Location 16:15832043-15832065
Sequence GATTGTGAACAGAGGCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134641393_1134641397 3 Left 1134641393 16:15832043-15832065 CCAGGAGGCCTCTGTTCACAATC No data
Right 1134641397 16:15832069-15832091 TTGTTCCTTGTGTCCCCGGGTGG No data
1134641393_1134641395 -1 Left 1134641393 16:15832043-15832065 CCAGGAGGCCTCTGTTCACAATC No data
Right 1134641395 16:15832065-15832087 CTGCTTGTTCCTTGTGTCCCCGG No data
1134641393_1134641402 22 Left 1134641393 16:15832043-15832065 CCAGGAGGCCTCTGTTCACAATC No data
Right 1134641402 16:15832088-15832110 GTGGACACTGCTTCCAGAGTAGG No data
1134641393_1134641396 0 Left 1134641393 16:15832043-15832065 CCAGGAGGCCTCTGTTCACAATC No data
Right 1134641396 16:15832066-15832088 TGCTTGTTCCTTGTGTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134641393 Original CRISPR GATTGTGAACAGAGGCCTCC TGG (reversed) Intronic
No off target data available for this crispr