ID: 1134649596

View in Genome Browser
Species Human (GRCh38)
Location 16:15898195-15898217
Sequence GAAGAAAGAGGAGGAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15746
Summary {0: 3, 1: 42, 2: 638, 3: 3072, 4: 11991}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134649596_1134649608 27 Left 1134649596 16:15898195-15898217 CCTCCCCCTCCTCCTCTTTCTTC 0: 3
1: 42
2: 638
3: 3072
4: 11991
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649596_1134649610 28 Left 1134649596 16:15898195-15898217 CCTCCCCCTCCTCCTCTTTCTTC 0: 3
1: 42
2: 638
3: 3072
4: 11991
Right 1134649610 16:15898246-15898268 CCCCCAACCCCCTCTCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134649596 Original CRISPR GAAGAAAGAGGAGGAGGGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr