ID: 1134649597

View in Genome Browser
Species Human (GRCh38)
Location 16:15898198-15898220
Sequence GGAGAAGAAAGAGGAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134649597_1134649610 25 Left 1134649597 16:15898198-15898220 CCCCCTCCTCCTCTTTCTTCTCC No data
Right 1134649610 16:15898246-15898268 CCCCCAACCCCCTCTCTACTGGG No data
1134649597_1134649608 24 Left 1134649597 16:15898198-15898220 CCCCCTCCTCCTCTTTCTTCTCC No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134649597 Original CRISPR GGAGAAGAAAGAGGAGGAGG GGG (reversed) Intergenic
No off target data available for this crispr