ID: 1134649602

View in Genome Browser
Species Human (GRCh38)
Location 16:15898207-15898229
Sequence GAGGGCGAGGGAGAAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134649602_1134649608 15 Left 1134649602 16:15898207-15898229 CCTCTTTCTTCTCCCTCGCCCTC No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649602_1134649610 16 Left 1134649602 16:15898207-15898229 CCTCTTTCTTCTCCCTCGCCCTC No data
Right 1134649610 16:15898246-15898268 CCCCCAACCCCCTCTCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134649602 Original CRISPR GAGGGCGAGGGAGAAGAAAG AGG (reversed) Intergenic
No off target data available for this crispr