ID: 1134649607 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:15898229-15898251 |
Sequence | TGGGGGAGAGAAAAGAAGAG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1134649607_1134649610 | -6 | Left | 1134649607 | 16:15898229-15898251 | CCTCTCTTCTTTTCTCTCCCCCA | No data | ||
Right | 1134649610 | 16:15898246-15898268 | CCCCCAACCCCCTCTCTACTGGG | No data | ||||
1134649607_1134649608 | -7 | Left | 1134649607 | 16:15898229-15898251 | CCTCTCTTCTTTTCTCTCCCCCA | No data | ||
Right | 1134649608 | 16:15898245-15898267 | TCCCCCAACCCCCTCTCTACTGG | No data | ||||
1134649607_1134649619 | 23 | Left | 1134649607 | 16:15898229-15898251 | CCTCTCTTCTTTTCTCTCCCCCA | No data | ||
Right | 1134649619 | 16:15898275-15898297 | CATGTGCCCATCCCCCAGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1134649607 | Original CRISPR | TGGGGGAGAGAAAAGAAGAG AGG (reversed) | Intergenic | ||
No off target data available for this crispr |