ID: 1134649607

View in Genome Browser
Species Human (GRCh38)
Location 16:15898229-15898251
Sequence TGGGGGAGAGAAAAGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134649607_1134649610 -6 Left 1134649607 16:15898229-15898251 CCTCTCTTCTTTTCTCTCCCCCA No data
Right 1134649610 16:15898246-15898268 CCCCCAACCCCCTCTCTACTGGG No data
1134649607_1134649608 -7 Left 1134649607 16:15898229-15898251 CCTCTCTTCTTTTCTCTCCCCCA No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649607_1134649619 23 Left 1134649607 16:15898229-15898251 CCTCTCTTCTTTTCTCTCCCCCA No data
Right 1134649619 16:15898275-15898297 CATGTGCCCATCCCCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134649607 Original CRISPR TGGGGGAGAGAAAAGAAGAG AGG (reversed) Intergenic
No off target data available for this crispr