ID: 1134649608

View in Genome Browser
Species Human (GRCh38)
Location 16:15898245-15898267
Sequence TCCCCCAACCCCCTCTCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134649605_1134649608 -3 Left 1134649605 16:15898225-15898247 CCCTCCTCTCTTCTTTTCTCTCC No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649604_1134649608 2 Left 1134649604 16:15898220-15898242 CCTCGCCCTCCTCTCTTCTTTTC No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649598_1134649608 23 Left 1134649598 16:15898199-15898221 CCCCTCCTCCTCTTTCTTCTCCC No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649601_1134649608 18 Left 1134649601 16:15898204-15898226 CCTCCTCTTTCTTCTCCCTCGCC No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649596_1134649608 27 Left 1134649596 16:15898195-15898217 CCTCCCCCTCCTCCTCTTTCTTC 0: 3
1: 42
2: 638
3: 3072
4: 11991
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649602_1134649608 15 Left 1134649602 16:15898207-15898229 CCTCTTTCTTCTCCCTCGCCCTC No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649597_1134649608 24 Left 1134649597 16:15898198-15898220 CCCCCTCCTCCTCTTTCTTCTCC No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649607_1134649608 -7 Left 1134649607 16:15898229-15898251 CCTCTCTTCTTTTCTCTCCCCCA No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649606_1134649608 -4 Left 1134649606 16:15898226-15898248 CCTCCTCTCTTCTTTTCTCTCCC No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649600_1134649608 21 Left 1134649600 16:15898201-15898223 CCTCCTCCTCTTTCTTCTCCCTC No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649599_1134649608 22 Left 1134649599 16:15898200-15898222 CCCTCCTCCTCTTTCTTCTCCCT No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data
1134649603_1134649608 3 Left 1134649603 16:15898219-15898241 CCCTCGCCCTCCTCTCTTCTTTT No data
Right 1134649608 16:15898245-15898267 TCCCCCAACCCCCTCTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134649608 Original CRISPR TCCCCCAACCCCCTCTCTAC TGG Intergenic
No off target data available for this crispr