ID: 1134649684

View in Genome Browser
Species Human (GRCh38)
Location 16:15898688-15898710
Sequence GAATTAGCCAGGAAAGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134649684_1134649690 7 Left 1134649684 16:15898688-15898710 CCTAAAGCTTTCCTGGCTAATTC No data
Right 1134649690 16:15898718-15898740 CTTCTCAAATGTATCTTGGGGGG No data
1134649684_1134649693 27 Left 1134649684 16:15898688-15898710 CCTAAAGCTTTCCTGGCTAATTC No data
Right 1134649693 16:15898738-15898760 GGGTGAAAGGTCTGAGAAGAGGG No data
1134649684_1134649689 6 Left 1134649684 16:15898688-15898710 CCTAAAGCTTTCCTGGCTAATTC No data
Right 1134649689 16:15898717-15898739 TCTTCTCAAATGTATCTTGGGGG No data
1134649684_1134649694 30 Left 1134649684 16:15898688-15898710 CCTAAAGCTTTCCTGGCTAATTC No data
Right 1134649694 16:15898741-15898763 TGAAAGGTCTGAGAAGAGGGAGG No data
1134649684_1134649687 4 Left 1134649684 16:15898688-15898710 CCTAAAGCTTTCCTGGCTAATTC No data
Right 1134649687 16:15898715-15898737 CTTCTTCTCAAATGTATCTTGGG No data
1134649684_1134649692 26 Left 1134649684 16:15898688-15898710 CCTAAAGCTTTCCTGGCTAATTC No data
Right 1134649692 16:15898737-15898759 GGGGTGAAAGGTCTGAGAAGAGG No data
1134649684_1134649691 14 Left 1134649684 16:15898688-15898710 CCTAAAGCTTTCCTGGCTAATTC No data
Right 1134649691 16:15898725-15898747 AATGTATCTTGGGGGGTGAAAGG No data
1134649684_1134649688 5 Left 1134649684 16:15898688-15898710 CCTAAAGCTTTCCTGGCTAATTC No data
Right 1134649688 16:15898716-15898738 TTCTTCTCAAATGTATCTTGGGG No data
1134649684_1134649686 3 Left 1134649684 16:15898688-15898710 CCTAAAGCTTTCCTGGCTAATTC No data
Right 1134649686 16:15898714-15898736 TCTTCTTCTCAAATGTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134649684 Original CRISPR GAATTAGCCAGGAAAGCTTT AGG (reversed) Intergenic
No off target data available for this crispr