ID: 1134649691

View in Genome Browser
Species Human (GRCh38)
Location 16:15898725-15898747
Sequence AATGTATCTTGGGGGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134649684_1134649691 14 Left 1134649684 16:15898688-15898710 CCTAAAGCTTTCCTGGCTAATTC No data
Right 1134649691 16:15898725-15898747 AATGTATCTTGGGGGGTGAAAGG No data
1134649685_1134649691 3 Left 1134649685 16:15898699-15898721 CCTGGCTAATTCGATTCTTCTTC No data
Right 1134649691 16:15898725-15898747 AATGTATCTTGGGGGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134649691 Original CRISPR AATGTATCTTGGGGGGTGAA AGG Intergenic
No off target data available for this crispr