ID: 1134662069

View in Genome Browser
Species Human (GRCh38)
Location 16:15991771-15991793
Sequence GTTCAAGGCCACTGCAGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134662069_1134662074 16 Left 1134662069 16:15991771-15991793 CCGACTCTGCAGTGGCCTTGAAC No data
Right 1134662074 16:15991810-15991832 CCCTTTCGTTGCCTTGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134662069 Original CRISPR GTTCAAGGCCACTGCAGAGT CGG (reversed) Intronic
No off target data available for this crispr