ID: 1134662279

View in Genome Browser
Species Human (GRCh38)
Location 16:15993163-15993185
Sequence TGGGCTAGTCACAGGCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134662279_1134662287 -4 Left 1134662279 16:15993163-15993185 CCCCCATGCCTGTGACTAGCCCA No data
Right 1134662287 16:15993182-15993204 CCCAGGTCTAGGCATATAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134662279 Original CRISPR TGGGCTAGTCACAGGCATGG GGG (reversed) Intronic
No off target data available for this crispr