ID: 1134662287

View in Genome Browser
Species Human (GRCh38)
Location 16:15993182-15993204
Sequence CCCAGGTCTAGGCATATAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134662279_1134662287 -4 Left 1134662279 16:15993163-15993185 CCCCCATGCCTGTGACTAGCCCA No data
Right 1134662287 16:15993182-15993204 CCCAGGTCTAGGCATATAGTAGG No data
1134662280_1134662287 -5 Left 1134662280 16:15993164-15993186 CCCCATGCCTGTGACTAGCCCAG No data
Right 1134662287 16:15993182-15993204 CCCAGGTCTAGGCATATAGTAGG No data
1134662283_1134662287 -7 Left 1134662283 16:15993166-15993188 CCATGCCTGTGACTAGCCCAGGT No data
Right 1134662287 16:15993182-15993204 CCCAGGTCTAGGCATATAGTAGG No data
1134662281_1134662287 -6 Left 1134662281 16:15993165-15993187 CCCATGCCTGTGACTAGCCCAGG No data
Right 1134662287 16:15993182-15993204 CCCAGGTCTAGGCATATAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134662287 Original CRISPR CCCAGGTCTAGGCATATAGT AGG Intronic
No off target data available for this crispr