ID: 1134662931

View in Genome Browser
Species Human (GRCh38)
Location 16:15997770-15997792
Sequence CCTGCCGGTAAGGAACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134662922_1134662931 18 Left 1134662922 16:15997729-15997751 CCTCCTGGAGTTGTTAAAGTAAA No data
Right 1134662931 16:15997770-15997792 CCTGCCGGTAAGGAACATCCAGG No data
1134662923_1134662931 15 Left 1134662923 16:15997732-15997754 CCTGGAGTTGTTAAAGTAAAGAA 0: 1
1: 0
2: 1
3: 19
4: 220
Right 1134662931 16:15997770-15997792 CCTGCCGGTAAGGAACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134662931 Original CRISPR CCTGCCGGTAAGGAACATCC AGG Intronic
No off target data available for this crispr