ID: 1134669546

View in Genome Browser
Species Human (GRCh38)
Location 16:16044643-16044665
Sequence CACGACCTGATGATGTTTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134669539_1134669546 21 Left 1134669539 16:16044599-16044621 CCTTTGGGCCCTACTTCCTCATG 0: 1
1: 0
2: 0
3: 19
4: 133
Right 1134669546 16:16044643-16044665 CACGACCTGATGATGTTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 95
1134669541_1134669546 12 Left 1134669541 16:16044608-16044630 CCTACTTCCTCATGAGCTTCTTC 0: 1
1: 0
2: 0
3: 26
4: 342
Right 1134669546 16:16044643-16044665 CACGACCTGATGATGTTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 95
1134669540_1134669546 13 Left 1134669540 16:16044607-16044629 CCCTACTTCCTCATGAGCTTCTT 0: 1
1: 0
2: 0
3: 13
4: 315
Right 1134669546 16:16044643-16044665 CACGACCTGATGATGTTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 95
1134669542_1134669546 5 Left 1134669542 16:16044615-16044637 CCTCATGAGCTTCTTCTTCAAGG 0: 1
1: 0
2: 1
3: 21
4: 191
Right 1134669546 16:16044643-16044665 CACGACCTGATGATGTTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134669546 Original CRISPR CACGACCTGATGATGTTTTC CGG Exonic
900324917 1:2104038-2104060 CACCACATAATGAGGTTTTCTGG + Intronic
900539458 1:3195655-3195677 GCAGCCCTGATGATGTTTTCAGG - Intronic
903836781 1:26209116-26209138 CACGACCTGATATTATTTTTAGG + Intergenic
909584020 1:77269568-77269590 CATCACATGATGATGATTTCAGG - Intergenic
912503222 1:110136298-110136320 CAGGACTTGATGATGTTTGAGGG + Intergenic
912792784 1:112669193-112669215 CAAGACTTGATGATGTCTTTTGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919378615 1:196825729-196825751 CAAGACCTTATGATCTTGTCTGG - Intronic
919390816 1:196983137-196983159 CAAGACCTTATGATCTTGTCCGG - Intronic
1062921617 10:1284724-1284746 CACTACCTGATGCTCTTTTGAGG + Intronic
1064932249 10:20640749-20640771 CACCACCTGAGGAGGTTGTCAGG + Intergenic
1065287572 10:24200846-24200868 CAGGACCTGATGATATTCCCAGG - Intronic
1068541391 10:58298624-58298646 CACGAACTCATGATTTTTTATGG - Intergenic
1069063062 10:63914252-63914274 CACCACCTGATGATGAGTTGAGG + Intergenic
1070019007 10:72565307-72565329 CACGAACTCATCATGTTTTATGG - Intronic
1083684584 11:64368789-64368811 CACGACCAGGTGATGGCTTCCGG + Exonic
1092330130 12:7579160-7579182 CAAGACCTGATGATTTTATAAGG - Intergenic
1094371024 12:29737651-29737673 CAAGCCCTTATGGTGTTTTCTGG - Intronic
1099831255 12:87845523-87845545 CACATCCTGATGATGTTATGTGG + Intergenic
1100823735 12:98455680-98455702 CAACACACGATGATGTTTTCAGG - Intergenic
1109655878 13:65389012-65389034 CAAGACCTGATGATTTTATAAGG + Intergenic
1111549977 13:89795607-89795629 CACGACCTCATTATTTTTTATGG - Intergenic
1111621729 13:90732809-90732831 CAAGATCTGATGATTTTATCAGG + Intergenic
1115143636 14:30201745-30201767 CAAGACCTGATGATTTTATAAGG + Intergenic
1118429999 14:65708203-65708225 CAAGACCTGATGGTTTTATCAGG + Intronic
1120787702 14:88551856-88551878 CCAGACCTGTTGATGGTTTCTGG + Intronic
1120869531 14:89324701-89324723 CACAACCTGCTGTGGTTTTCAGG - Intronic
1134669546 16:16044643-16044665 CACGACCTGATGATGTTTTCCGG + Exonic
1135958702 16:26978046-26978068 CACAAGAAGATGATGTTTTCTGG - Intergenic
1141241717 16:82271115-82271137 CAGGATCTGATGATTTTATCAGG - Intergenic
1141950872 16:87338611-87338633 CATGATCTGATGATGTTCCCAGG - Intronic
1144213507 17:13034775-13034797 CAAGATCTGATGATTTTATCAGG - Intergenic
1151447149 17:74174645-74174667 CACGCCCAGATGATTTTTTTTGG - Intergenic
1157217085 18:45793229-45793251 CGGGACCTGCTGAGGTTTTCTGG - Intergenic
1160074401 18:75658571-75658593 CAAGAACTGATGTTGCTTTCAGG + Intergenic
1164823786 19:31269297-31269319 CAAGCCCTGATGAGGCTTTCAGG + Intergenic
931594328 2:63924970-63924992 AAAGACTTGAAGATGTTTTCTGG - Intronic
939869809 2:147514508-147514530 CAAAAACAGATGATGTTTTCAGG + Intergenic
940019406 2:149141064-149141086 CACCACCTGATGATTTTTGTTGG - Intronic
940506998 2:154568515-154568537 CACGACCAAAAGAAGTTTTCAGG - Intergenic
941268864 2:163400197-163400219 CACAACCTGATTTTTTTTTCTGG + Intergenic
941705421 2:168653513-168653535 CATGACCTGAGGACATTTTCTGG + Intronic
943833039 2:192486155-192486177 CAAGATCTGATGATTTTATCAGG + Intergenic
944721915 2:202431518-202431540 CACCACTTAATGATGTTTTTTGG + Intronic
944872913 2:203932446-203932468 CAAGAACTGAAGATGTCTTCGGG - Intergenic
1172406791 20:34695759-34695781 CACGACCTGCTAATTTTTTTTGG - Intergenic
1174276214 20:49406320-49406342 GACAACCTCATGGTGTTTTCTGG + Intronic
1176687438 21:9863219-9863241 CACGACCTGATGGTTTTATAAGG + Intergenic
949733431 3:7142482-7142504 CAAGACCTGATGATTTTATAAGG - Intronic
951634414 3:24757227-24757249 CAGGACCACATGAAGTTTTCTGG - Intergenic
953685935 3:45078444-45078466 CAAGACCTGATGGTTTTGTCAGG + Intergenic
954945882 3:54424043-54424065 CATGACATGCTAATGTTTTCCGG + Intronic
960791650 3:121438396-121438418 TACGAATTGATTATGTTTTCTGG - Intronic
961569679 3:127788751-127788773 CACGCCCTGATGATGAACTCTGG - Intronic
963291407 3:143493652-143493674 CAGCACATGATGATGTTTTCAGG - Exonic
975506860 4:75147910-75147932 CAAGATCTGATGATTTTATCAGG - Intergenic
975859432 4:78660641-78660663 CACGATCTGAAGATGTTTAAGGG + Intergenic
979214016 4:118140750-118140772 CAAGACCTGATGATTTTATAAGG - Intronic
979853766 4:125606691-125606713 CAAGAACTGCTGAAGTTTTCAGG - Intergenic
980199182 4:129632904-129632926 CAAGACCTGATGGTTTTATCAGG - Intergenic
980350841 4:131681334-131681356 CACGACCTGATGGTTTTATAAGG + Intergenic
980635916 4:135502802-135502824 CAAGAGCTGATGGTGTTTTCTGG - Intergenic
980657366 4:135807080-135807102 CAAGATCTGATGATTTTATCGGG + Intergenic
981254309 4:142643502-142643524 CTTGACCTGATGATGGTTGCAGG + Intronic
982880176 4:160704306-160704328 CACGAACTCATCATTTTTTCTGG + Intergenic
983719898 4:170837896-170837918 CACAAGCTGTTGATGTTTTTTGG + Intergenic
984362546 4:178754396-178754418 CAATACCTGATGATATTTCCTGG - Intergenic
986416046 5:7529333-7529355 CACAACATTATTATGTTTTCAGG + Intronic
986446955 5:7829784-7829806 CCCGGCCTGATGATGTTACCTGG - Exonic
987904863 5:24062936-24062958 CAATAATTGATGATGTTTTCAGG + Intronic
988319265 5:29670805-29670827 CAAGATCTGATGGTTTTTTCAGG + Intergenic
989086700 5:37684623-37684645 CACAACCTGATTTTGTTTTCTGG + Intronic
994587534 5:101728981-101729003 CAATACCTGGGGATGTTTTCTGG - Intergenic
994916185 5:105982746-105982768 GACGACCTGTTGATGTTAGCAGG + Intergenic
996793462 5:127318360-127318382 AAAAACTTGATGATGTTTTCAGG + Intronic
1000400833 5:160825383-160825405 CAAGACCTGATGATTTTATAAGG + Intronic
1005921872 6:30408495-30408517 CAAGACCTGACGATTTTATCAGG + Intergenic
1012511680 6:100009875-100009897 CACCACCTCATAATGTTTTCTGG - Intergenic
1015233422 6:130942919-130942941 CACGAACTGATGCTTTTTTATGG + Intronic
1015253026 6:131147000-131147022 CATGACGTGAGGATGTGTTCAGG + Intronic
1020397934 7:7738419-7738441 CAGGACCTGGTGATGTTTAATGG + Intronic
1024046391 7:45588596-45588618 CTGGCCCTGGTGATGTTTTCAGG + Intronic
1028058477 7:86278581-86278603 CTCTAACTGATTATGTTTTCCGG + Intergenic
1034526358 7:151665742-151665764 CAAGACCTGATGAGGTTGTAAGG + Intronic
1036978105 8:13437770-13437792 TATGACCTGATGGTGTTTGCTGG - Intronic
1037445661 8:18963129-18963151 CAAGACCTGATGGTTTTATCAGG - Intronic
1044442220 8:92236373-92236395 CAAGATCTGATGATTTTATCAGG - Intergenic
1044542865 8:93427380-93427402 TACGATCTGATGATGCTTTTGGG - Intergenic
1044814637 8:96098989-96099011 CAGGCCCTGATGCTGTTTGCAGG - Intergenic
1044899322 8:96927257-96927279 TACTTCCTGATGATGTTTTTAGG + Intronic
1053781867 9:41618381-41618403 CACGACCTGATGGTTTTATAAGG - Intergenic
1054169817 9:61828535-61828557 CACGACCTGATGGTTTTATAAGG - Intergenic
1054667721 9:67752280-67752302 CACGACCTGATGGTTTTATAAGG + Intergenic
1058481722 9:105402611-105402633 CACTCCCTGATAATGATTTCTGG + Intronic
1059427824 9:114232063-114232085 CACTATCTGCTGAGGTTTTCGGG - Intronic
1185573848 X:1154743-1154765 CACGCCCGGCTGATGTTTTTAGG + Intergenic
1187760586 X:22579731-22579753 CACGACCTCATCATTTTTTATGG - Intergenic
1189997015 X:46648685-46648707 CAACACATGATGATGTTTTCAGG - Exonic
1198374301 X:136022676-136022698 CAACACATGATGATGTTTGCTGG + Exonic
1199362756 X:146942555-146942577 CAAGATCTGATGGTTTTTTCAGG - Intergenic
1201437756 Y:13977807-13977829 CAGGACCTGATGGTTTTATCAGG + Intergenic