ID: 1134680871

View in Genome Browser
Species Human (GRCh38)
Location 16:16124599-16124621
Sequence CGCAGGGTAGGGAGGGCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134680871_1134680881 15 Left 1134680871 16:16124599-16124621 CCTTCGGCCCTCCCTACCCTGCG 0: 1
1: 0
2: 2
3: 25
4: 228
Right 1134680881 16:16124637-16124659 TTGAAAAAGCAGTGCCAGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 363
1134680871_1134680882 26 Left 1134680871 16:16124599-16124621 CCTTCGGCCCTCCCTACCCTGCG 0: 1
1: 0
2: 2
3: 25
4: 228
Right 1134680882 16:16124648-16124670 GTGCCAGGAAGGACTCTCTCTGG 0: 1
1: 0
2: 1
3: 30
4: 255
1134680871_1134680880 11 Left 1134680871 16:16124599-16124621 CCTTCGGCCCTCCCTACCCTGCG 0: 1
1: 0
2: 2
3: 25
4: 228
Right 1134680880 16:16124633-16124655 TGTTTTGAAAAAGCAGTGCCAGG 0: 1
1: 0
2: 1
3: 33
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134680871 Original CRISPR CGCAGGGTAGGGAGGGCCGA AGG (reversed) Intronic
900290829 1:1922925-1922947 CCCAGGGCAGGGGAGGCCGAGGG + Intronic
900417946 1:2543620-2543642 CACAGGCGAGGGAGGGCTGAGGG - Intergenic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
901634505 1:10664334-10664356 CTCAGGGGAGGGTGGGCCGGGGG - Intronic
902342673 1:15794249-15794271 AGCAGGGTAGGGAGGGGCTTGGG - Intergenic
902515452 1:16987274-16987296 CACAGGGAAGGGAGGACAGAGGG + Intronic
902723870 1:18322695-18322717 GGCAGGGGCGGGAGGGCCCAGGG - Intronic
903189341 1:21648065-21648087 AGCTGGGAAGGGAGGGCCTAGGG + Intronic
903652099 1:24928842-24928864 GGCAGGGCAGGAAGGGCCGGCGG - Intronic
903792760 1:25906064-25906086 CGCAGGGAAGGGAGGGAGGGAGG + Intronic
903847208 1:26285579-26285601 GGCAGGGCAGGGTGGGCCCAAGG - Intronic
905175945 1:36135411-36135433 CGGAGGAGAGGAAGGGCCGAGGG + Intergenic
905936463 1:41827923-41827945 GGCAGGGAAGGGAGGGAAGAGGG + Intronic
906495601 1:46302401-46302423 CGCAGGACAGGGAGCGCCGGAGG - Intronic
908544805 1:65151811-65151833 GGCAGTGTAGGAAGGGCCAATGG - Intronic
913186486 1:116373956-116373978 CTCAGGGCACGGAGGGCGGAGGG - Exonic
913491179 1:119381369-119381391 GGCAGGGGAGGGAGGGCTGATGG + Intronic
913714432 1:121519477-121519499 GCCAGGGTAGGGAGGGCGGAGGG + Intergenic
914677899 1:149917880-149917902 CGCGGGGTAGGGGGGGGCGGAGG - Exonic
914941036 1:152023289-152023311 GGCAGGGAACGGAGGGCAGATGG - Intergenic
915731642 1:158058402-158058424 GGCAGGGCAGGGAGGGAGGAGGG - Intronic
918067899 1:181113732-181113754 GGCAGGGAAGGGAGGTCCGCGGG - Intergenic
918276269 1:182956123-182956145 AGCAGGGCAGGGAGTGCAGAAGG + Intergenic
919753560 1:201053089-201053111 AGCAAGGCAGGGAGGGCGGAGGG + Intronic
921916063 1:220611517-220611539 AGCAGGGCAGGGAGGCACGAGGG - Intronic
923914343 1:238485587-238485609 GGCAGGGAAGGGAGGGCGGTGGG + Intergenic
1063462156 10:6221751-6221773 CGCAGGCTGGGGCGGGCTGACGG + Intronic
1067060121 10:43073982-43074004 CACAGGGAAGGGAGGGAGGAGGG - Intergenic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1069832355 10:71289070-71289092 TGCAGGGCAGGGAGAGCTGAAGG + Intronic
1070162946 10:73876583-73876605 AGAAGGGTAGAGAGGGCCAAGGG + Intergenic
1070577513 10:77690513-77690535 AGCAGGCTAGGGAGGGCAGCAGG + Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1071273985 10:84036023-84036045 CGCAGTGTTGGGAGGGCCACAGG - Intergenic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1074887545 10:117705815-117705837 CTCAGGGAAGGGAGGACCCAAGG - Intergenic
1075031797 10:119029297-119029319 GGCCGGGAAGGGAGGGCCGCTGG - Intergenic
1076266051 10:129110667-129110689 AGCAGGGTAGAGAAGGCAGAGGG + Intergenic
1076313088 10:129521953-129521975 TGCAGGGCACGCAGGGCCGATGG + Intronic
1076915254 10:133420170-133420192 GTCCGGGTAGGGAGGGCCGGAGG + Exonic
1077245723 11:1536904-1536926 TGCAGGGCAGAGAGGGCCCAGGG - Intergenic
1077602018 11:3580865-3580887 CGCAGGGTAGGGGCGGCGGGAGG - Intergenic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1078527321 11:12110749-12110771 CTCAGGGTGGGGAGGGCGGGCGG + Intronic
1081357779 11:42134536-42134558 GGAAGGGTAGTGGGGGCCGAGGG + Intergenic
1084046154 11:66568663-66568685 CGCAGGGTAGGGAGAGCGGGAGG + Intronic
1084150341 11:67285204-67285226 GCCAGGGATGGGAGGGCCGAGGG + Intronic
1084190732 11:67497570-67497592 CGCTGGGGAGGCAAGGCCGAGGG + Exonic
1084534938 11:69751064-69751086 CGCAGGCTAGGGAGGGGCAGAGG + Intergenic
1084557886 11:69885706-69885728 GGCAGAGTGGGGAGGGCTGAGGG + Intergenic
1084557904 11:69885748-69885770 GGCAGAGTGGGGAGGGCTGAGGG + Intergenic
1084814836 11:71639826-71639848 CGCGGGGTAGGGACGGCGGGAGG + Intergenic
1085763538 11:79262416-79262438 CTCAGGGTAGGGAGCCCCAAAGG + Intronic
1088537211 11:110874403-110874425 AGCAGGGTAGGGAGGCAGGAGGG - Intergenic
1090029582 11:123195408-123195430 GGCCGGGCAGGGAGGGCCGGGGG + Intergenic
1091445334 12:541804-541826 GGCAGGGAGAGGAGGGCCGAGGG - Intronic
1091807544 12:3366675-3366697 CCCAGGGAATGCAGGGCCGATGG - Intergenic
1092208924 12:6633793-6633815 AGCAGAGTAGGGAGAGCAGATGG + Intronic
1092428161 12:8390208-8390230 CGCAGGGTAGGGGCGGCGGGAGG - Intergenic
1095049866 12:37545870-37545892 GGCAGGGGAGGGAGGGCCATGGG - Intergenic
1096677221 12:53232290-53232312 GGCAGGGGAGGGAGGAGCGAGGG - Intronic
1096749055 12:53747365-53747387 TGCAGGGAGGGGAGGGCCAAGGG - Intergenic
1098171521 12:67751803-67751825 CGCAGTGGCTGGAGGGCCGAAGG - Intergenic
1102587303 12:113932461-113932483 AGAAGGAGAGGGAGGGCCGAGGG - Intronic
1105913963 13:24895135-24895157 GCCAGGGCAGGGAAGGCCGAGGG + Intronic
1107820970 13:44285387-44285409 GGCAGGGTAGGCAGGGAGGAGGG - Intergenic
1108063356 13:46553699-46553721 GGCAGGTGAGTGAGGGCCGAGGG + Exonic
1111944891 13:94654630-94654652 CACAGGGTAGGGATAGTCGATGG + Intergenic
1113186569 13:107693321-107693343 CGTAGGGTAGGGGGGGCGGGAGG + Intronic
1113910746 13:113840101-113840123 CGCAAGGTGGGAAGGGCTGAGGG + Intronic
1115649116 14:35390539-35390561 GGCAGGATGGGGAGGGCTGAGGG + Intergenic
1117432729 14:55685510-55685532 GGCAGAATAGGGAGGGCAGAAGG - Intronic
1120948592 14:90020639-90020661 GGCAGGGGAGGGAGGGAGGAAGG - Intronic
1121001284 14:90453742-90453764 CGCAGTGGAGGGAGGCCCGGGGG - Intergenic
1123067766 14:105627004-105627026 TGCAGGGTGGGGAGGGCCAAGGG - Intergenic
1123068702 14:105630614-105630636 TGCAGGGTGGGGAGGTCCAAGGG + Intergenic
1123071785 14:105645729-105645751 CGCAGGGTGGGGAGGGCCAAGGG - Intergenic
1123072698 14:105649417-105649439 TGCAGGGTGGGGAGGTCCAAGGG + Intergenic
1123091449 14:105744005-105744027 TGCAGGGTGGGGAGGGCCAAGGG - Intergenic
1123092726 14:105748942-105748964 TGCAGGGTGGGGAGGTCCAAGGG + Intergenic
1123097219 14:105772346-105772368 CGCAGGGTGGGGAGGGCCAAGGG - Intergenic
1123098289 14:105776642-105776664 TGCAGGGTGGGGAGGTCCAAGGG + Intergenic
1123471987 15:20562450-20562472 CGCAGGGTGGGGAGGGAGGCGGG - Intergenic
1123646016 15:22437903-22437925 CGCAGGGTGGGGAGGGAGGCGGG + Intergenic
1123667321 15:22617757-22617779 CGCAGGGTGGGGAGGGAGGCAGG + Intergenic
1123750426 15:23354823-23354845 CGCAGGGTGGGGAGGGAGGCGGG - Intronic
1124282796 15:28378739-28378761 CGCAGGGTGGGGAGGGAGGCGGG - Exonic
1124299903 15:28532874-28532896 CGCAGGGTGGGGAGGGAGGCGGG + Exonic
1124321163 15:28712324-28712346 CGCAGGGTGGGGAGGGAGGCAGG + Intronic
1124481334 15:30083030-30083052 CGCAGGGTGGGGAGGGAGGCAGG - Intergenic
1124487789 15:30135126-30135148 CGCAGGGTGGGGAGGGAGGCAGG - Intergenic
1124493748 15:30174022-30174044 CCCAGGGAAGGGAGGGCTGGGGG + Intergenic
1124522260 15:30414163-30414185 TGCAGGGTGGGGAGGGAGGAAGG + Intergenic
1124536405 15:30552055-30552077 TGCAGGGTGGGGAGGGAGGAAGG - Intergenic
1124542880 15:30604103-30604125 CGCAGGGTGGGGAGGGAGGCAGG - Intergenic
1124749819 15:32364627-32364649 CCCAGGGAAGGGAGGGCTGGGGG - Intergenic
1124755739 15:32403195-32403217 CGCAGGGTGGGGAGGGAGGCAGG + Exonic
1124762246 15:32455537-32455559 TGCAGGGTGGGGAGGGAGGAAGG + Exonic
1124776383 15:32593531-32593553 CGCAGGGTGGGGAGGGAGGAAGG - Exonic
1125191318 15:36997416-36997438 CACAGGGTTGGAAGGGCCCATGG + Intronic
1125201915 15:37107484-37107506 CGCCGGGTAGGGAGGTCAGAGGG + Intergenic
1125674504 15:41494943-41494965 CGCAGGGGAGGGAGGGGCGTGGG + Intronic
1125744087 15:41987377-41987399 TGCAGGGGAGGGAGGGATGAAGG + Intronic
1126688444 15:51267933-51267955 CCCAGGGTGGGGAGGGGCGAAGG - Intronic
1126933546 15:53681275-53681297 GGCAGCGTGGGGAGGGCAGATGG + Intronic
1127604610 15:60573865-60573887 CACAGGCCAGGGAGGGCCCAAGG - Intronic
1129389436 15:75213322-75213344 CGGCGGGAAGGGAGGACCGAAGG - Intergenic
1129682794 15:77667404-77667426 AGCAGAATAGGGAGGGGCGAGGG + Intronic
1129937862 15:79465750-79465772 GCCAGGGTAGGGAGGGCTGCTGG + Intronic
1130994120 15:88894846-88894868 AGAAGGGTAGGGAGGGTGGAGGG - Intronic
1132028972 15:98425285-98425307 TGCAGGGGAGGGAAGGCAGAGGG + Intergenic
1134680871 16:16124599-16124621 CGCAGGGTAGGGAGGGCCGAAGG - Intronic
1134747642 16:16600484-16600506 AGCAGGGGAGGGAGGGCAGAGGG - Intergenic
1134997825 16:18753175-18753197 AGCAGGGGAGGGAGGGCAGAGGG + Intergenic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1135040528 16:19114178-19114200 CGCCGGGCGGGGAGGGCCGCTGG + Intronic
1135047787 16:19168730-19168752 CGCGCGGAAGGGAGGGCCCACGG + Intronic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1137981212 16:53071721-53071743 CGCAGGGTGAGCAGGACCGAGGG - Intronic
1139263916 16:65622193-65622215 GGCATGGTAGGGAGAGCAGAGGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1142756011 17:2016805-2016827 CTCAGGGGAGGCAGGGCCGAGGG - Intronic
1142967748 17:3591737-3591759 GGCAGGGCAGGGAGGGCCACAGG - Intronic
1142980424 17:3668232-3668254 CGCAGGGCGGGGAGGGCCACGGG - Intronic
1143365443 17:6405494-6405516 CATAGGGTAGGGAGGGCAGGTGG + Intronic
1143733644 17:8895471-8895493 AGCAGGGTCAGGAGGGCAGAGGG - Intronic
1146339552 17:32007508-32007530 GGCCGGGTTGGGAGGCCCGAGGG - Intergenic
1146373836 17:32281344-32281366 CCCAGGCTGGGGAGGGCCGTGGG - Intronic
1147323143 17:39657947-39657969 CCCAGGGGAGGGAGGGAGGAAGG - Intronic
1148238314 17:45983663-45983685 CCCAGTGTAGGGCGGGCCAAAGG + Exonic
1149867606 17:60159359-60159381 AGCAGGGCAGGCAGGGCCCAGGG - Exonic
1150832697 17:68538340-68538362 GGCAGGGAAGGGAGGCCAGAGGG + Intronic
1151453376 17:74212625-74212647 TGCAGAGTACGGAGGGCCCAGGG + Intergenic
1151674904 17:75592337-75592359 CCCAGAGTAGGAAGGGCAGAGGG + Intergenic
1151954131 17:77372373-77372395 CACAAGGCAGGCAGGGCCGAGGG - Intronic
1152024189 17:77798077-77798099 TGCGGGGTAGGGAGGGCCGTGGG - Intergenic
1152409979 17:80118254-80118276 CCAAGGGTGGGGAGGCCCGAGGG + Intergenic
1152568109 17:81109179-81109201 CACAGGGGAGGGGGGGCGGATGG - Intronic
1152754604 17:82081969-82081991 GGCAGGGTGGGCAGGGTCGAGGG + Intronic
1155241429 18:23867137-23867159 AGGAGGGTGGGGAGGGCAGAGGG - Intronic
1158453354 18:57586387-57586409 CGCGGAGAAGGGAGGGCTGAGGG - Intronic
1158658176 18:59359457-59359479 CGGAGGGTGGGCGGGGCCGAAGG - Exonic
1158799580 18:60890519-60890541 AGCAGGGCAGGGAGGGATGATGG - Intergenic
1160154365 18:76422294-76422316 CGCAGTGCAGGGAGTGCCGAGGG - Intronic
1161296995 19:3525196-3525218 CGCAGCGTTGGGAGGGCAGTTGG + Intronic
1161426761 19:4207946-4207968 CGCTGGGTGGGGAGGGGCGCTGG - Exonic
1161984487 19:7646221-7646243 GGCAGGGCAGGGAGGGCAGCAGG - Intronic
1163190482 19:15673415-15673437 GGCAGGGCAGGGAGGGCTCAGGG - Intronic
1165788704 19:38477898-38477920 TGCAGGGTGGGGAGGGCAGGAGG + Intronic
1168588917 19:57616667-57616689 GGCAGGGTAGGCAGGGCTTAGGG + Intronic
926685044 2:15691679-15691701 CGCAGGCTTGGAAGGGCCGCAGG + Intronic
927141670 2:20135224-20135246 TGCAGGGTAGGTAGGGCTGCAGG - Intergenic
927152876 2:20205779-20205801 CACAGTGTAGGGTGGGCTGATGG - Intronic
927873682 2:26640366-26640388 GGCAGGGATGGGAGGGCCCAGGG - Intronic
927966772 2:27275341-27275363 CGCAGGGAAGCGAGAGCGGAGGG - Intronic
928903334 2:36344627-36344649 CGGAGGGGAGGGAGGGGAGAAGG + Intergenic
934656389 2:96118615-96118637 TGCAGGGTGGGGAGGGCACACGG - Intergenic
936015850 2:108958548-108958570 CGCACAGTAGAGAGGGCAGAAGG + Intronic
936986806 2:118319300-118319322 GGCAGGAAAGGGAGGGCAGAGGG - Intergenic
937094003 2:119224123-119224145 CGCAGGTTAGGCAGGGCCGGCGG + Intronic
938306898 2:130262738-130262760 TGCAGGGAAAGGAGGGCAGAGGG - Intergenic
938572073 2:132570130-132570152 AGCTGGGTGGGGAGGGCCAAGGG - Intronic
943731160 2:191305238-191305260 GGCAGGGTAAGTAGGGCCAAAGG + Intronic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946158188 2:217820584-217820606 CCCAGGCTAGGGAGGGCAGTGGG + Intronic
946302351 2:218831721-218831743 CGCAGGGTATGGGGGTCCCAGGG - Exonic
947436578 2:230078256-230078278 AGAAAGGTAGGGAGGGCAGAAGG - Intergenic
948436366 2:237956542-237956564 AGCAGACTAGGGAGGGCTGATGG + Intergenic
1168757621 20:327312-327334 CCCAGGGAAGGGAGGGGCGCAGG - Exonic
1169398763 20:5261151-5261173 TGCAGGGATGGGAGGGCAGAAGG + Intergenic
1172113889 20:32562767-32562789 AGCAGAATGGGGAGGGCCGAGGG - Intronic
1174655220 20:52166253-52166275 GGCAGGGTGGGCAGGGCAGATGG + Intronic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1177949606 21:27517969-27517991 CGCAGAGTAGGGAGTGCCCTGGG - Intergenic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180180267 21:46115822-46115844 GGCAGGGTAGGGTGGGCGGTAGG - Intronic
1181427669 22:22855014-22855036 CACAGGAGAGGGGGGGCCGAGGG - Intronic
1181477994 22:23180484-23180506 CGCAGGAAGGGGAGGGCCGGGGG - Exonic
1181519342 22:23436396-23436418 AGCAGGGATTGGAGGGCCGATGG + Intergenic
1181934611 22:26429583-26429605 CGCCGGTAAGGGAGGGCCGTGGG - Intronic
1182352079 22:29704804-29704826 CTCAGGGTTGGGAGGGCAGTGGG + Intergenic
1183392986 22:37556410-37556432 TGCATGGAAGGGAGGGCAGATGG + Intergenic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183605337 22:38864521-38864543 GGCAGGGTAGGGAGGGGCCGAGG + Exonic
1183821101 22:40346547-40346569 CGCAGGGTTGGGATGGCGGCTGG + Exonic
1184275042 22:43405227-43405249 CTGAGGGTGGGGAGGGCCGGAGG + Intergenic
1184644556 22:45889048-45889070 TGCAGGGAAGGGTGGGCGGAGGG - Intergenic
1184960231 22:47923194-47923216 AGCAGGGATGAGAGGGCCGAGGG + Intergenic
950032691 3:9862856-9862878 CGCAGGCTGGGTGGGGCCGATGG + Intergenic
954371699 3:50172394-50172416 CCAAGGGGAGGGAGAGCCGAGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
959562896 3:107802773-107802795 TGCAGGGTAGGGAGTGTGGAGGG - Intronic
962272259 3:133986504-133986526 TGCAGGGCAGGGAGGGCAGGAGG + Intronic
964556844 3:157949150-157949172 AGCAGGTCAGGGAGGGACGAAGG + Intergenic
966928859 3:184662892-184662914 CGCAGGTTAGCGGGGCCCGACGG + Intronic
966933711 3:184691941-184691963 CGCTGGGCAGGGGGGGCCGGCGG + Intergenic
966944841 3:184770517-184770539 CGCAGGGTAGTGAGGTGGGATGG - Intergenic
967937015 3:194737145-194737167 GGCAGGGTGGGGAGGGAAGAGGG - Intergenic
968712196 4:2127124-2127146 CGGAGGGTAGGGAGGGGTGAGGG + Intronic
969297640 4:6279156-6279178 CGCAGGGAGGGCAGGGCCCAGGG + Intronic
969476388 4:7424762-7424784 GGCATGGTAGGGAGGGCTTAAGG - Intronic
969643453 4:8412798-8412820 CGCAGGGCAGCGAGGGAGGATGG - Intronic
969737488 4:9001115-9001137 CGCGGGGTAGGGTGGGCGGGAGG + Intergenic
973938649 4:55879537-55879559 TGCAGGGTAGGGAGGGGAGATGG + Intronic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978618107 4:110615389-110615411 TGCAGGGGCGGGAGGGGCGAGGG + Intergenic
980722525 4:136716914-136716936 TGCAGGGAAGGGAGGGCAGAGGG - Intergenic
989963313 5:50441000-50441022 TCCAGGGTAGGGAGGGCGGAGGG - Intronic
991340301 5:65601657-65601679 GGCAGGGTTTGGAGGGGCGAGGG - Intronic
992527338 5:77625183-77625205 CGCAGGGCTTGGAAGGCCGAGGG + Intergenic
993207862 5:84908145-84908167 GGAAGGGTGGGGAGGGGCGAGGG - Intergenic
997209133 5:132067423-132067445 CACAGGGCAGGGAGGGCTCATGG - Intergenic
997382115 5:133445475-133445497 GTCAGGGCAGGCAGGGCCGATGG - Intronic
998415439 5:141942756-141942778 TGCAGGGAAGGCAGGGCTGAGGG + Intergenic
999231625 5:150065352-150065374 AGCAGGGAAGGGAGGGTCCAGGG - Intronic
1001045920 5:168371542-168371564 CACAGGGAAGGGAGGACCGTCGG - Intronic
1006302377 6:33200410-33200432 CGCAGGGCAGTGTGGGCCGGTGG - Exonic
1011493491 6:87916330-87916352 AGCAGGGCAGGGAGGGCCAGGGG - Intergenic
1018869323 6:167769162-167769184 CGCAGGGCTGGGAGGGCTGACGG + Intergenic
1019058743 6:169241074-169241096 CCCAGGGCAGGGAGGGCGGCAGG - Intronic
1019416707 7:931012-931034 AGGAGGGTAGGGAGGGACGGAGG + Intronic
1019478201 7:1254311-1254333 CGGTGGGTGGGGAGGGCCGCTGG - Intergenic
1021549288 7:21852626-21852648 CACAAGGTAGGAAGGGCAGAGGG + Exonic
1022536638 7:31102548-31102570 GGCAGGGGAGGAAGGGCCGGAGG - Intronic
1023402854 7:39802937-39802959 AGCAGGGTAGGGAGGGGCTTGGG - Intergenic
1023674624 7:42616871-42616893 AGCAGGGTAGAGAGGGCCAGAGG + Intergenic
1025259355 7:57407306-57407328 CGGAGGATAGGGAAGGCCAAGGG - Intergenic
1029730406 7:102434494-102434516 CTCAGGGCAGTGAGGGCTGAGGG - Intronic
1032552683 7:132799898-132799920 TGTGGGGTAGGGAGGGCCAAAGG - Intronic
1034263637 7:149771786-149771808 CGCAGGGGAGAGAGGGCGGAAGG - Intronic
1034781464 7:153886429-153886451 TCCAGGGTAGGGAGAGCCGTGGG + Intergenic
1036798094 8:11770094-11770116 CCCCGGGCAGGGAGGGCCGGAGG + Exonic
1037776244 8:21837817-21837839 GGCAGGATAGGGTGGGCAGAGGG - Intergenic
1039616527 8:38958896-38958918 CGCAGGGGAGGGAGTGCTGGGGG + Intronic
1040312111 8:46242112-46242134 CGCAGGGTGGGGTGGGCGGGCGG + Intergenic
1041044280 8:53877191-53877213 CGTAGGGTCGGGAAGGCCGTGGG + Intronic
1042902769 8:73746144-73746166 GGGAGGGTAGGTGGGGCCGAGGG - Intronic
1049361023 8:142212694-142212716 CCCAGGAGAGGGAGGGCCGGTGG - Intronic
1049399436 8:142418321-142418343 CGCAGGGCAGAGGGGGCAGAGGG + Intergenic
1049789205 8:144465419-144465441 GGCAGAGGAGGCAGGGCCGACGG - Intronic
1052610900 9:30772791-30772813 GGCAGGGCAGAGAGGGCTGAAGG - Intergenic
1053270336 9:36745282-36745304 TGCAGGGCAGCGAGGGCCAAGGG - Intergenic
1059029247 9:110672448-110672470 CATAGGGTAGGGAGGACAGATGG + Intronic
1060105431 9:120870015-120870037 GGCAGGGCTGGGAGGGCTGAGGG + Intronic
1060952701 9:127613504-127613526 CGCAGCGGAGCGAGGGCTGATGG + Intronic
1061201678 9:129141790-129141812 GGCAGGGAAGAGAGGGCCGATGG - Intronic
1061724179 9:132572505-132572527 GGCAGGGGAGGGAGGGGCTAGGG - Exonic
1062145582 9:134988008-134988030 CCCAGGGTGGGGAAGGCCAAGGG - Intergenic
1062344584 9:136109046-136109068 GGCAGGGCGGGGAGGGCAGAGGG - Intergenic
1185848736 X:3465248-3465270 AGCAGGGTTGGGAGGGCCCTGGG - Intergenic
1191798260 X:65046880-65046902 CACAGGATAGGGATGCCCGAGGG + Intergenic
1198311141 X:135426374-135426396 GGCGGGGGAGGGAGGGCAGAGGG + Intergenic
1200064006 X:153496214-153496236 GGCAGGCCAGGGAGGGGCGAGGG - Intronic
1200814907 Y:7521582-7521604 AGCAGGGTTGGGAGGGCCCTGGG + Intergenic
1202101255 Y:21310185-21310207 CACAGGGTAGGGAGGGGCTTCGG + Intergenic