ID: 1134681589

View in Genome Browser
Species Human (GRCh38)
Location 16:16129823-16129845
Sequence TCACAGCGTTGCCGGCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134681589_1134681592 1 Left 1134681589 16:16129823-16129845 CCACTGCGCCGGCAACGCTGTGA No data
Right 1134681592 16:16129847-16129869 TTTATAGCACGTCCACAAAAGGG No data
1134681589_1134681594 29 Left 1134681589 16:16129823-16129845 CCACTGCGCCGGCAACGCTGTGA No data
Right 1134681594 16:16129875-16129897 TGTCTTGCCTAAAAGTTGCCCGG No data
1134681589_1134681591 0 Left 1134681589 16:16129823-16129845 CCACTGCGCCGGCAACGCTGTGA No data
Right 1134681591 16:16129846-16129868 TTTTATAGCACGTCCACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134681589 Original CRISPR TCACAGCGTTGCCGGCGCAG TGG (reversed) Intronic
No off target data available for this crispr