ID: 1134683286

View in Genome Browser
Species Human (GRCh38)
Location 16:16141514-16141536
Sequence GTCTCAGGGCACCAGGGGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 367}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134683286_1134683293 2 Left 1134683286 16:16141514-16141536 CCCTGCCCCTGGTGCCCTGAGAC 0: 1
1: 0
2: 2
3: 35
4: 367
Right 1134683293 16:16141539-16141561 ACACACAGCCTCACGCCCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 242
1134683286_1134683300 21 Left 1134683286 16:16141514-16141536 CCCTGCCCCTGGTGCCCTGAGAC 0: 1
1: 0
2: 2
3: 35
4: 367
Right 1134683300 16:16141558-16141580 CAGGAATGCAAGTGGTTTCCTGG 0: 1
1: 0
2: 1
3: 21
4: 215
1134683286_1134683295 13 Left 1134683286 16:16141514-16141536 CCCTGCCCCTGGTGCCCTGAGAC 0: 1
1: 0
2: 2
3: 35
4: 367
Right 1134683295 16:16141550-16141572 CACGCCCCCAGGAATGCAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134683286 Original CRISPR GTCTCAGGGCACCAGGGGCA GGG (reversed) Exonic
900087210 1:904349-904371 GGCTCAGGACGCCAGGGTCAGGG + Intergenic
900151636 1:1181511-1181533 GTCACAGGCAACCAGGGGCGGGG - Intronic
900560770 1:3304936-3304958 GACGCCGGGCACCAGGGACATGG - Intronic
900951079 1:5858601-5858623 GTCTGAGGGGAGCAGGGGGATGG - Intergenic
901302367 1:8209095-8209117 GACTCAGGTGCCCAGGGGCAGGG + Intergenic
901457557 1:9371924-9371946 GTCTGAGTGCACCAGGGAGATGG - Intergenic
901657743 1:10780024-10780046 CTCTCTGGGCACAAGGGCCAGGG - Intronic
902511846 1:16970868-16970890 GGCTCAGGGCTCCTGGGGGAGGG - Intronic
903180242 1:21601656-21601678 GGCTCAGGGCACGTGGGGCTTGG - Intronic
903216157 1:21844353-21844375 GTATCTGGGCCCCAGGGGAAGGG - Intronic
903293695 1:22330377-22330399 GCCACATGGCACCAGGAGCAGGG + Intergenic
903304216 1:22401296-22401318 GCATCAGGGCATCATGGGCATGG - Intergenic
903369268 1:22824839-22824861 GTCCCAGGGCACCTGTGGCCAGG + Intronic
903649063 1:24912027-24912049 GTCTCAGAGCCACAGGGCCAGGG + Intronic
904154062 1:28467501-28467523 GCCTCAGCTCACAAGGGGCAAGG + Intronic
904255283 1:29250797-29250819 ATCTCAAGGGACCAGGGGAAGGG + Intronic
906476670 1:46173913-46173935 GTCCCAGGGCCGCAGGGGCAGGG + Intronic
906684918 1:47757039-47757061 GTCTCAGGGCAGCAGAGGTGAGG + Intergenic
907439957 1:54472974-54472996 GGCTCAGGGCCCTTGGGGCAGGG - Intergenic
907491218 1:54810105-54810127 GCCTCTGGGCTCCAGGAGCAGGG + Intronic
907713011 1:56901825-56901847 GACACAGGGCAGCAGGGTCAGGG - Intronic
910494521 1:87811589-87811611 GTCTCAGGGCCCCAGGTCAATGG - Intergenic
912508828 1:110174739-110174761 GTCACAGGGCCTCAGTGGCAGGG - Intronic
913436365 1:118851536-118851558 TTCTGGTGGCACCAGGGGCAGGG + Intergenic
915308199 1:154993200-154993222 CTCTAAGGGGCCCAGGGGCAGGG + Intergenic
915579954 1:156807629-156807651 GTCTCAGGTGATCAGTGGCATGG + Intronic
916595361 1:166237264-166237286 CTCTCAGGGTACCAGGCTCAAGG - Intergenic
916982497 1:170153978-170154000 GTTTCAGGGGACCAGGCCCAGGG + Intronic
917003744 1:170388646-170388668 GCCTGAGGGCAGCAGGGGAAGGG + Intergenic
917846773 1:179026245-179026267 GGCTCAGGGCACCCGGTGCCCGG - Intronic
919819666 1:201465231-201465253 CTCCCAGGGTAGCAGGGGCAGGG + Intergenic
919928527 1:202206377-202206399 GTCTCAGGCCACCATGGACCCGG + Intronic
920517830 1:206599675-206599697 GCCCCAGGGCACCTGGGCCACGG - Intronic
920541481 1:206781735-206781757 GACTTAGGGAACCGGGGGCAAGG - Intergenic
921280470 1:213561583-213561605 GACTCAGGGCAACAGTGGTAAGG - Intergenic
921301315 1:213753958-213753980 CTCCCAGGGCTTCAGGGGCATGG - Intergenic
922802367 1:228370276-228370298 GCCTGAGGCCAACAGGGGCAGGG + Intronic
922889174 1:229047161-229047183 AGCTCAGGTCACGAGGGGCAGGG - Intergenic
923042266 1:230327707-230327729 GGCTCAGCGCACCAGGCGCCAGG + Intronic
923085968 1:230703852-230703874 GGCCCAGGGCACCAGGTCCAGGG + Intronic
923773599 1:236959125-236959147 GTCTCAGAGAACCTGGAGCAAGG + Intergenic
924638423 1:245810355-245810377 GCCTCAGGGCGCCAGAGTCATGG - Intronic
924776023 1:247114833-247114855 CTCTGAGGGCTCCAGGAGCAAGG + Intergenic
1068674568 10:59757521-59757543 GTCTCAGAGCCCCACGGGAAAGG + Intergenic
1068860903 10:61846700-61846722 GTCTCAGGGCACAAGAGGATTGG + Intergenic
1069728296 10:70595238-70595260 GTCTGAAGGGACAAGGGGCACGG + Intergenic
1069756372 10:70776427-70776449 GTCTCAGGGGACCTGGCCCATGG + Intronic
1071361649 10:84852077-84852099 GTCTGAGGGCTGCAGGGGCCAGG - Intergenic
1071692789 10:87839954-87839976 GTCTCTGGCCACCACTGGCAGGG - Intronic
1074155216 10:110792610-110792632 GTCACCAGGCACCAGGGTCAGGG - Intronic
1075443636 10:122498886-122498908 TTCTCAGGGGACCAGGGACTGGG - Intronic
1075587643 10:123669103-123669125 GTCCCAGGGCACTGGGAGCAGGG - Intronic
1076740103 10:132478651-132478673 TCCTCTGGGCCCCAGGGGCAGGG - Intergenic
1077393861 11:2311786-2311808 TTCTCAGGACACCTGGGGGAAGG - Intronic
1078402893 11:11044020-11044042 AACTCAGGGCACCAGGAGGAGGG + Intergenic
1078715351 11:13834271-13834293 GTCTCTAGGGACCAGGGGGAGGG + Intergenic
1078969647 11:16393079-16393101 GTCTCAGGGAACCAGAGTCACGG - Intronic
1079355552 11:19727470-19727492 TTCCCAGGGCACCAGTGGGAGGG + Intronic
1079735658 11:23994118-23994140 GCCTGAGGGCAGCAAGGGCAGGG - Intergenic
1079882589 11:25945049-25945071 GCCTCAGAGCAGCAGGGGCAAGG - Intergenic
1079991240 11:27249057-27249079 GCCTCAGGGCTCCAGAGGCCTGG + Intergenic
1079998332 11:27320084-27320106 GTCCAAGGGCTCAAGGGGCAGGG - Intergenic
1081252300 11:40850736-40850758 GGGACAGGGCACCAGGGGGAAGG - Intronic
1081567224 11:44267439-44267461 TTCTCAGAGCACCAGGGGCTGGG + Intronic
1084253055 11:67917372-67917394 GTTTCAGGTCAGCAGGGTCAGGG + Intergenic
1084266716 11:68008784-68008806 GGCCCAGGGCACCAGGGAGATGG + Intronic
1084268580 11:68017354-68017376 CACTCAGCGAACCAGGGGCAAGG - Intronic
1084295793 11:68213019-68213041 GTCGCAGGGCTCCGGGGCCAGGG - Intronic
1084440538 11:69170235-69170257 GCCTCAGGGCACCTGGGAGATGG - Intergenic
1085040245 11:73322624-73322646 GTCTGAGGCCAAGAGGGGCAGGG + Intronic
1085482108 11:76831173-76831195 GTCTCATGGGACAAGGGGAAGGG - Intergenic
1086068767 11:82775901-82775923 ATCTCTGGGCACTAGGGGGAGGG + Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089560926 11:119342726-119342748 GTCTGCAGGCACAAGGGGCATGG + Exonic
1090423167 11:126589448-126589470 GACTCAGGGCACCATGGGCTTGG + Intronic
1090669919 11:128938853-128938875 GTCTCAGGGCAGCAGGGAGTGGG + Intronic
1091184611 11:133636614-133636636 GTCTCTGGGCATCACTGGCAGGG - Intergenic
1091350925 11:134893426-134893448 CTCTTAGGGCAGCAGGGTCAAGG + Intergenic
1091931784 12:4402425-4402447 CTCTCAAGGCTCCAGGGCCAGGG - Intergenic
1091961265 12:4696628-4696650 CTCTCAGGGCTCCAGGGTCTTGG + Intronic
1093022560 12:14217282-14217304 GCCTGAGGACACCATGGGCAAGG - Intergenic
1093769483 12:23002484-23002506 CTCTAAGGGAACCAGGGGCTGGG + Intergenic
1094310443 12:29074789-29074811 GGATCAAGGCAACAGGGGCATGG + Intergenic
1094464269 12:30735388-30735410 GTCTCAGGTAACCAGAGCCAAGG + Intronic
1094481504 12:30885845-30885867 GTCTCATGGAGCCAGGGACACGG + Intergenic
1101708716 12:107245004-107245026 TTCTCAAGGCACTAGGGTCAGGG - Intergenic
1101825758 12:108218827-108218849 GGCTGTGGGCACCAGGTGCAAGG + Intronic
1102258544 12:111429842-111429864 GCCGGGGGGCACCAGGGGCAGGG + Intronic
1102871442 12:116417267-116417289 TTCTCAGGAAACCAGGGGAATGG - Intergenic
1103678171 12:122673005-122673027 CTCTCAGGGAACAGGGGGCAGGG - Intergenic
1103713472 12:122929705-122929727 GGCTCAGGGCAGCAGGGGTAAGG + Exonic
1103722048 12:122980443-122980465 TTCCCAGGGCACCGGGGGCGTGG + Exonic
1104623856 12:130337679-130337701 GTCTTGGGGGGCCAGGGGCAGGG + Intergenic
1108425312 13:50293283-50293305 GGCTTAGGGCTCCTGGGGCATGG - Intronic
1110060481 13:71033167-71033189 GCCTGAGGGCAACAGGGGCAAGG - Intergenic
1111598944 13:90447148-90447170 GAATCAGGGTGCCAGGGGCAAGG - Intergenic
1111604424 13:90519609-90519631 ATCTCAGGGCAACAGGAGCAAGG - Intergenic
1113600471 13:111564889-111564911 GTCTCCAGGCCCCAGTGGCAAGG - Intergenic
1113917164 13:113881327-113881349 GGGTGAGGGCACCAGGGCCATGG - Intergenic
1113958448 13:114112233-114112255 TTAGCAGGGCACCAGGGGCCAGG + Intronic
1115897302 14:38104740-38104762 GCCTGGGGGCACCATGGGCAAGG - Intergenic
1117339536 14:54781653-54781675 GTCTGTGGCCACGAGGGGCAGGG + Intronic
1117971700 14:61257387-61257409 GTCTCAGTGCACAGTGGGCATGG + Intronic
1118192665 14:63594561-63594583 GTCCCAGGAAACCAGTGGCATGG + Intergenic
1118348989 14:64960176-64960198 TCCTCTGGGCACCGGGGGCAGGG + Intronic
1119247504 14:73125173-73125195 GCCTCAGGGCACCAGCTGCAGGG + Intergenic
1119634396 14:76262225-76262247 GTCTCAGTGCAGTGGGGGCAGGG - Intergenic
1121114083 14:91331424-91331446 GTCTCCAGGCCCCATGGGCAAGG + Intronic
1121234036 14:92379518-92379540 GAACCATGGCACCAGGGGCATGG + Intronic
1121546079 14:94764696-94764718 GTCTCAGGTCATCTGGGCCAAGG - Intergenic
1121907149 14:97757024-97757046 ATTTCAGGGCACCAGGAGCTGGG + Intronic
1121941792 14:98077735-98077757 CTCACATGGCACAAGGGGCAAGG + Intergenic
1122302479 14:100738952-100738974 CTCCCAGGCCACCAGGGCCAAGG - Intergenic
1122407099 14:101507120-101507142 GATTCTGGGCACCAGGGCCAGGG + Intergenic
1122881674 14:104693143-104693165 TGCCCAGGGCACCAGGGCCAGGG - Intronic
1122974195 14:105164337-105164359 GGCTCTGGGCCCCAGGGCCATGG + Intronic
1123759789 15:23423355-23423377 GCCCCAGGACACCAAGGGCAGGG + Intergenic
1123940320 15:25213526-25213548 GCTTCAGTGCACCAGGGGCTGGG - Intergenic
1123940732 15:25215422-25215444 GCTTCAGCGCACCAGGGGCTGGG - Intergenic
1125550452 15:40540847-40540869 GACTGAGGGCACCAGGGCAATGG - Intronic
1125748926 15:42015489-42015511 CTCTCAGAGCAACAGAGGCAGGG - Intronic
1126587940 15:50308457-50308479 GCATCACGGCAACAGGGGCAAGG + Intronic
1127661458 15:61103547-61103569 CTCTGTGGGCACCAGGGACAAGG - Intronic
1128812194 15:70580800-70580822 GGCTCAGGCCACCAGGAGCAGGG + Intergenic
1129039198 15:72671010-72671032 GGCTCTGGCCACTAGGGGCAGGG - Intergenic
1129321359 15:74776897-74776919 GACTCAGGGAACCAGGGGCCAGG - Intergenic
1130241354 15:82195845-82195867 GTCTCGGAGCTCCTGGGGCAAGG - Intronic
1130296291 15:82648631-82648653 GTCCTAGGGCACCTGGCGCAGGG + Intronic
1130303457 15:82697907-82697929 AGCTCAGGACACCAGGGGCATGG + Intronic
1130459069 15:84145308-84145330 GTCTCGGAGCTCCTGGGGCAAGG + Intergenic
1132294849 15:100727420-100727442 GTGTCAGGGGACCAGGGCCAGGG + Intergenic
1133026536 16:2991165-2991187 GAGTCAGGGCACCAGGAGCTGGG + Intergenic
1134456551 16:14399540-14399562 GCCCCAGGACACCAAGGGCAGGG - Intergenic
1134683286 16:16141514-16141536 GTCTCAGGGCACCAGGGGCAGGG - Exonic
1134829698 16:17313206-17313228 TTGCCAGGGCTCCAGGGGCAGGG - Intronic
1136291505 16:29275202-29275224 GGCTCAGGGCACCTGGGACATGG - Intergenic
1137983205 16:53086996-53087018 GGTTTAGGGCACCAGGTGCATGG - Intronic
1138505537 16:57476542-57476564 GACTCAGAGAACTAGGGGCACGG - Intronic
1139061984 16:63263770-63263792 GTCTGAGGGCAAGAGGAGCAAGG + Intergenic
1139479791 16:67224007-67224029 GTCTGAGGGCACCAGAGCCCTGG + Intronic
1139627303 16:68200538-68200560 GTCTCAGGCTTCCTGGGGCAAGG + Intronic
1139696682 16:68680127-68680149 GGCCCAAGGAACCAGGGGCATGG - Intronic
1140660780 16:77190249-77190271 GGCCCAGGGCACTTGGGGCAAGG + Intergenic
1141285930 16:82671960-82671982 GTCTCAGGGCAAGAGGGGGAGGG - Intronic
1141859770 16:86708596-86708618 GTCACAGGGGTCCAGAGGCACGG - Intergenic
1141982080 16:87556944-87556966 ATGCCAGGGCCCCAGGGGCAGGG + Intergenic
1142001901 16:87669019-87669041 TTCTCAGTGCTCCAAGGGCAGGG - Intronic
1142097381 16:88249127-88249149 GGCTCGGGGCACCTGGGACATGG - Intergenic
1142264068 16:89055520-89055542 GTCACGGGGCACCACTGGCAGGG + Intergenic
1143865234 17:9918535-9918557 CCATCAGGGCACCAGGGCCAGGG - Intronic
1143927284 17:10383105-10383127 GTCCCAGGGCATCATGGGAAGGG + Intergenic
1146055102 17:29577046-29577068 CTCTCAGGTCACCACTGGCAGGG + Intronic
1146270117 17:31479489-31479511 GTCCAAAGACACCAGGGGCATGG + Intronic
1146297611 17:31661926-31661948 GTCTCTGGGAACCAGGGCAATGG + Intergenic
1147862775 17:43533290-43533312 GTCCAAGGGCACCAGGGGCAGGG + Exonic
1148340494 17:46870626-46870648 TTCTGAGGGCACCTGGGGCCTGG + Intronic
1148744624 17:49911449-49911471 GGCTTCGGGCACCAGGTGCAGGG + Intergenic
1149683572 17:58521892-58521914 GGCCAAGAGCACCAGGGGCAGGG - Intronic
1151321006 17:73352367-73352389 GCACCAGGGCACCAGGAGCATGG - Intronic
1151630753 17:75309323-75309345 GCCACAGGGCTCCAGGGACAGGG - Intergenic
1151971731 17:77460824-77460846 GTCTCTGGGCAGAAGGGACAAGG - Intronic
1152128751 17:78463159-78463181 GTCTCAGGGCACCTTGTCCAGGG - Intronic
1152284484 17:79404278-79404300 GTCCCAGCCCACCAGGGGCCTGG + Intronic
1152375436 17:79916265-79916287 GTCACAGGTCACCTTGGGCAGGG + Intergenic
1152407778 17:80107460-80107482 CTCCCAGGGCACCAGGGCCCGGG + Intergenic
1152571663 17:81123768-81123790 GCCTCAGGCCAGCATGGGCAGGG + Intronic
1152734146 17:81988787-81988809 GTCTCAGGGCATCCCGGGCAGGG + Intronic
1153610524 18:6879929-6879951 GCAACAGGGCACCAGGGTCAAGG - Intronic
1153941999 18:9986578-9986600 GTCTCAGGCCATCAGGGGGTGGG + Intergenic
1154353949 18:13610717-13610739 GCCTCGGGGCTCCAGGGACAAGG + Intronic
1160149283 18:76387007-76387029 GTCTCAGGGCAGCAGGTGTCCGG - Intronic
1160521647 18:79511509-79511531 CTGTGAGGGCACCAGGGCCATGG + Intronic
1161088982 19:2350908-2350930 TTCTCAGGGGACTGGGGGCACGG + Intronic
1161301229 19:3544070-3544092 GTCCCAGGGGACCAGAGGCTCGG + Intronic
1161377903 19:3949607-3949629 GTCTCAGGGTTCCCGGGGCCTGG + Intergenic
1161457037 19:4374735-4374757 GACTCAGGGGCCCAGGGGCCAGG - Intronic
1162038618 19:7955990-7956012 CGCTCTGGGCAGCAGGGGCAGGG - Intergenic
1162398189 19:10430176-10430198 CTCTCAGAGCACCACTGGCAGGG + Intronic
1162938526 19:13994156-13994178 GTCTCTGGGTACCAGGGACTGGG - Intronic
1162968101 19:14165277-14165299 CCCTCAGGGCATCAGGGACAGGG - Intronic
1163267884 19:16232662-16232684 GTCCCCGTGCACCTGGGGCAGGG - Intronic
1163319875 19:16568344-16568366 TTATCAGAGCGCCAGGGGCAGGG + Intronic
1163469049 19:17486400-17486422 CTCTCAGTGGACCAAGGGCAAGG - Intronic
1163678259 19:18666272-18666294 GGCTCAGGGCTACAGGGGCAAGG - Intronic
1165935583 19:39386656-39386678 GGCTCAGGGCACCCATGGCAGGG - Intronic
1167556182 19:50197404-50197426 GTGTCAGGGGTCCAGGGGGATGG + Intronic
1167664987 19:50818648-50818670 CTGGCTGGGCACCAGGGGCAGGG - Intergenic
925152664 2:1625889-1625911 GCCTGAGGGCTCTAGGGGCAAGG + Intergenic
925154483 2:1639163-1639185 GTCCCAGGGCACTGGGGGCCAGG - Intronic
925187565 2:1859778-1859800 GTATCAGGGCACCAGGGCCAGGG - Intronic
925318935 2:2947016-2947038 GTCTCAAGGCACATGGGGCAAGG + Intergenic
926166431 2:10524188-10524210 GTCTCAGGGAAACAGGGCGATGG + Intergenic
926272089 2:11374563-11374585 CTCACAGGGCCCCAGGGGCGAGG - Intergenic
927101358 2:19789950-19789972 GGCTCCGGTCACCAGAGGCAGGG - Intergenic
927517907 2:23682703-23682725 GGCTCAGAGCACCAGTGGGAGGG - Intronic
929596227 2:43178032-43178054 GTATGAGTGCACCAGGGCCAGGG - Intergenic
929963123 2:46511320-46511342 GCCTCAGGGCACCAGGGGACTGG + Intronic
930838981 2:55825321-55825343 GCCTGAGGGCAACAGGAGCAAGG - Intergenic
932450960 2:71810586-71810608 GACTCTGGGCACCTGGGGGATGG + Intergenic
932497705 2:72154656-72154678 GTCCCAGGACCCCAGGGCCAGGG + Intergenic
932581103 2:72993193-72993215 TTGTGAGGGCACCGGGGGCAAGG + Intronic
933484061 2:82896362-82896384 GCCTGAGGGCAGCAGGAGCAGGG - Intergenic
934040892 2:88126700-88126722 CTCTCTGGTCACCAGGGGTATGG - Intronic
935718555 2:105959996-105960018 GTCTCAGGAGCCCAGGGGGAGGG - Intergenic
936522843 2:113222423-113222445 GTCACATGGAACCTGGGGCAGGG + Intronic
937317893 2:120943612-120943634 GTCCCAAAGCACCAGGGGCATGG - Intronic
938370786 2:130767183-130767205 GTGTCAGGCCAGCAGGTGCAGGG + Exonic
938408646 2:131046361-131046383 TCTTCAGGGCACCAGGAGCAGGG - Exonic
939200835 2:139031738-139031760 AGCTCAGGGCCCAAGGGGCAGGG + Intergenic
940004473 2:148998517-148998539 GGCCCAGGGCACCAGGGGTGTGG + Intronic
941136441 2:161723161-161723183 GTCCCAAGGCACTAGTGGCATGG + Intronic
942678852 2:178455555-178455577 GTCCCAGGGCATCAGGAGAAAGG + Intronic
946985743 2:225271004-225271026 GCCACAGGCCACCAGGGGTAAGG - Intergenic
947579652 2:231307145-231307167 CTCACAGTGCCCCAGGGGCAGGG + Intronic
947744771 2:232501915-232501937 CTCTCAGAGCTCCAAGGGCAGGG + Intergenic
947793164 2:232879161-232879183 GTCCCTGGGGGCCAGGGGCATGG + Exonic
948156023 2:235782147-235782169 GACGCAGGGCACCAAGAGCATGG + Intronic
948601686 2:239111223-239111245 TTCTCATGGCCCCACGGGCATGG + Intronic
948780768 2:240320282-240320304 GTCTGAGGGCCCCAGCGGGAGGG + Intergenic
949027691 2:241774128-241774150 GCCCCAGGGCCCCAGGGCCATGG - Intergenic
949046856 2:241876417-241876439 GTCTCAGGGGCCCAATGGCAGGG + Intergenic
1168898178 20:1338234-1338256 ATCCCAGGGCACTGGGGGCAGGG + Intronic
1169549258 20:6685355-6685377 GTCTCACGGCATCATGGGCCTGG - Intergenic
1170407765 20:16056850-16056872 CTCACATGGCACCAGGGGCAAGG - Intergenic
1170654801 20:18276547-18276569 GTCTCAGGGCTCTCAGGGCATGG - Intergenic
1170868994 20:20187318-20187340 GGCCCAGGGTGCCAGGGGCAGGG + Intronic
1172600651 20:36180346-36180368 ACCTCAGTGCACCTGGGGCAAGG + Intronic
1172615100 20:36278097-36278119 CTCTGAGGGCACCTGGGGCTTGG + Intergenic
1172657715 20:36547104-36547126 GTCTCAGGGGTTCAGGGGCCTGG - Intronic
1173246563 20:41341346-41341368 GTCTCAGGGCAAGCAGGGCAAGG - Intronic
1174354720 20:49990119-49990141 CTCTCAGGGCACCTGGAGCAAGG + Intergenic
1174363068 20:50040435-50040457 GTCTCTAGGCACTGGGGGCAGGG + Intergenic
1174800676 20:53560662-53560684 CTCTGAGAGCTCCAGGGGCAGGG - Intergenic
1175785716 20:61710583-61710605 GCCCCAGGGCCCCAGAGGCAGGG - Intronic
1176204864 20:63882832-63882854 GTCTCAGGGCAGCAGAGTCAGGG - Intronic
1176223101 20:63979311-63979333 GTCTCAGGGACCCAGAGGCACGG - Intronic
1176273436 20:64248392-64248414 CTGTCAGGGCCTCAGGGGCAGGG - Intergenic
1176303552 21:5111428-5111450 ATCTCAGGGCCCTGGGGGCATGG + Intergenic
1176949427 21:15027196-15027218 GTTGCAAGACACCAGGGGCAAGG + Intronic
1179289759 21:40008157-40008179 GTGTGGTGGCACCAGGGGCAAGG - Intergenic
1179827777 21:43977404-43977426 TTCTCATGGGACCAGGGGCGTGG + Intronic
1179853479 21:44150522-44150544 ATCTCAGGGCCCTGGGGGCATGG - Intergenic
1181022800 22:20112505-20112527 CTCCCAGGGCCCCAGGGGCGGGG - Exonic
1181243724 22:21491796-21491818 GTCTCAGGGTACCAGGTGTCTGG - Intergenic
1181263252 22:21613895-21613917 GTCTCAGGGTTCCAGGGTGAAGG + Intronic
1181406074 22:22685935-22685957 GTCCCAGGGTCCCAGGGTCATGG - Intergenic
1181542426 22:23580461-23580483 CACCCAGGGCCCCAGGGGCAAGG - Intergenic
1181553345 22:23653437-23653459 GTCTGATGGTAGCAGGGGCATGG + Intergenic
1181601539 22:23955114-23955136 GTCACCTGGCAGCAGGGGCAGGG - Intergenic
1181940261 22:26470339-26470361 GTCTCTGGGCAGCAGGAGGAGGG + Intronic
1182372599 22:29822219-29822241 GACTCAGGGCGATAGGGGCAGGG - Intronic
1183208413 22:36434812-36434834 GTCCCAGGGCTCCAGGGGCGAGG - Intergenic
1184661048 22:45965653-45965675 GTCTCAGAGCTCCTGGGTCAGGG + Intronic
1185070514 22:48653329-48653351 GTCCTAGGGAACCGGGGGCAGGG - Intronic
1185133912 22:49057737-49057759 CTTTCAGGGGACCAGGGGAAAGG + Intergenic
1185227944 22:49663901-49663923 GTCTGGGGGCTGCAGGGGCAGGG - Intergenic
949482854 3:4510466-4510488 GACTCAGGTTAGCAGGGGCAAGG + Intronic
951269058 3:20603030-20603052 GCCTGATGGCAGCAGGGGCAGGG + Intergenic
951282684 3:20771987-20772009 GTCTCAGGAGACCAGGGAGAGGG + Intergenic
952670950 3:35967650-35967672 GTCACAGAGCATCAGTGGCAAGG + Intergenic
952883296 3:37998516-37998538 CTCTCAGGGCTCCCAGGGCAGGG - Intronic
954430707 3:50469593-50469615 ATCTCAGGGGAGCAGGAGCAAGG - Intronic
954654034 3:52183026-52183048 AAATCAGGACACCAGGGGCAGGG + Intergenic
955226538 3:57064766-57064788 GTCTCCAGGGACTAGGGGCAGGG + Intronic
958101672 3:89019816-89019838 GCCTCAGGGCAACAGGGGTCTGG + Intergenic
961371881 3:126436210-126436232 CTCTCCCTGCACCAGGGGCAGGG + Intronic
961508633 3:127387968-127387990 CTCCCAGGTCCCCAGGGGCAGGG - Intergenic
961736238 3:129003766-129003788 GGGACAGGGCAGCAGGGGCAGGG - Intronic
961871618 3:129992715-129992737 GTCACAGGGACCCAGGGGCTTGG - Intergenic
961983335 3:131104460-131104482 GCCTGAGGACAGCAGGGGCAGGG + Intronic
962605438 3:137029007-137029029 GTCTCATGGCCCCAGGGAAAGGG - Intergenic
962649320 3:137472715-137472737 GGCTCAGGGCTCCAGGAGGAAGG - Intergenic
962770954 3:138609411-138609433 GTCTCTGGGGAGCAGCGGCACGG - Intronic
962962326 3:140322034-140322056 ACCTCAGGGCCCCAGGGGAAAGG + Intronic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
967038199 3:185663996-185664018 CCCTCTGGGCACCAGGGACATGG + Intronic
967178977 3:186886602-186886624 GTCTCAGCAACCCAGGGGCATGG + Intergenic
967268708 3:187715090-187715112 GTCTCAGGACAGCAGGGCCATGG - Intronic
967621708 3:191642150-191642172 GCCTGAGGACAGCAGGGGCATGG - Intergenic
968572930 4:1351908-1351930 GTCCCAGGGCCCCAGCCGCAAGG + Intronic
968625096 4:1623434-1623456 GTCTCAGGCCACCAGGCCCCCGG + Intronic
968742782 4:2339870-2339892 CTCACAGGGCCCCAGGAGCAGGG + Intronic
968760042 4:2438012-2438034 GTCACGGGGCACCAGGCACACGG - Intronic
968925443 4:3544841-3544863 GTCTCATGACCCCAGGGACACGG + Intergenic
968928319 4:3561903-3561925 GTCTCAGGGGAGCAGAGGGATGG + Intergenic
968957253 4:3725729-3725751 GGCTCAGGCCGCCAGGGTCAGGG + Intergenic
969286424 4:6205208-6205230 GGCTCAGGGCACACGGGGCGGGG - Intergenic
969886881 4:10222873-10222895 GGCTGAGGGCACAAGGGCCATGG - Intergenic
971727180 4:30328444-30328466 GCTTCAGGGCAGCAGGGGCAGGG + Intergenic
971819302 4:31530740-31530762 GCCTGAGGGCAGTAGGGGCAGGG + Intergenic
972678819 4:41286174-41286196 GTGTCTGTGCACCAGGGGCTGGG - Intergenic
980352729 4:131701831-131701853 GTCTGAAGGCCCCAGGGGGAGGG + Intergenic
982600625 4:157444045-157444067 GCCTGAGGGCAGCAGGGGTAGGG + Intergenic
984829705 4:183961004-183961026 GTCACAGAGAACCAGGGGTAGGG - Intronic
984888733 4:184473475-184473497 GTCCCAGCGCGCCAGGGGCTCGG - Intronic
985485136 5:144583-144605 GTCTCTGGGCACATGGGGCTGGG - Intronic
985547680 5:518296-518318 GTCTCAGGGTACCAGGTCCTGGG - Intronic
985578735 5:685662-685684 GGCAGAGGGCACCAGGGGCTGGG - Intronic
985681535 5:1258307-1258329 ATCCCAGGGCAGCAGGGGCATGG - Intronic
987098862 5:14574856-14574878 GTCTCAGAGTACTAGGTGCAGGG + Intergenic
988796684 5:34657703-34657725 GTCTCAAGGCTGCAGGGGCCTGG + Intronic
991183253 5:63778927-63778949 TTCTAGGGGCCCCAGGGGCAAGG + Intergenic
992827961 5:80568972-80568994 GTCTCAGGGAACCAAGGTGATGG + Exonic
993574742 5:89587077-89587099 GTCCCAGGGTCCCAGGGACAAGG - Intergenic
993812490 5:92499156-92499178 GTGTCAGGGGACCAGTGGGAAGG - Intergenic
995218299 5:109620088-109620110 GTGTCAGGGAATCAGGGTCAAGG - Intergenic
996464484 5:123783439-123783461 GTCCCAGGGCACAAGTGGAAGGG + Intergenic
997364773 5:133318888-133318910 GTCTCAGGACCCCAGTGGCCAGG + Intronic
997716818 5:136048744-136048766 GGCTCAGGGCAGGAAGGGCAAGG + Intronic
997836677 5:137200008-137200030 GGCTCAGGGCACTAGGGGCTTGG - Intronic
998426220 5:142030825-142030847 AGCTCAGGGCACGTGGGGCAGGG + Intergenic
998882556 5:146658197-146658219 GTCCCAGAGCACCAGGGTCAGGG - Intronic
998959045 5:147465593-147465615 GTCTTAAGGGACCAGGGGCCGGG - Intronic
999498806 5:152126063-152126085 GTCCGAAGGCACCAGGGGCGGGG - Intergenic
1002085631 5:176773634-176773656 GTCTGAGGCCACCAAGTGCATGG + Intergenic
1002613969 5:180438905-180438927 TTCTCATGGCAGAAGGGGCAAGG - Intergenic
1002848425 6:969244-969266 GTCTCAGGGCTCCAGAGTCCTGG - Intergenic
1003672444 6:8171780-8171802 GTGTCAGGGCACGAGGGTCAAGG - Intergenic
1004127004 6:12883592-12883614 GTCTCAGGTCTCCTGGGGCCTGG - Intronic
1004304387 6:14487252-14487274 TTCTCAGGCCCCCAAGGGCACGG - Intergenic
1006016258 6:31083621-31083643 GTCTCAGGTTCCCAGGGGAAAGG - Intergenic
1006520930 6:34570739-34570761 GTGTCAGGGAAACAGGGACAGGG + Intergenic
1006684292 6:35819541-35819563 GCATCAGGACACCAGGGGCTGGG + Intronic
1007425970 6:41746361-41746383 CTCTCAGGACACCAGGACCACGG + Intronic
1010411631 6:75568191-75568213 GGCTCAAGGCCCCAGTGGCATGG - Intergenic
1011378768 6:86719945-86719967 TTCACAGGGCAGCAGGAGCAAGG + Intergenic
1012811688 6:103967053-103967075 GACTCAGGGCACCATGTCCAAGG + Intergenic
1013090974 6:106900650-106900672 GTCTCAGCTCTCCAGGGGGAGGG - Intergenic
1013405400 6:109838636-109838658 GATTCAGGGCACCATGGGCAGGG - Intergenic
1014532818 6:122579247-122579269 GTGTCAGGGCATCAGTGGAAAGG - Intronic
1014932376 6:127349410-127349432 ATCTGAGGGCACCAGCAGCAAGG + Intergenic
1015629275 6:135215307-135215329 TGCTCAGGGCACCAGGGCCTTGG - Intronic
1017549774 6:155493479-155493501 GAATCAGGGCAAGAGGGGCAAGG + Intergenic
1018642477 6:165917297-165917319 GTCTCACTGCACCAAGAGCATGG + Intronic
1019407589 7:891852-891874 GGCTCAGTGCCCCAGGGGCAGGG - Intronic
1019663916 7:2241959-2241981 CCCTCAGGTCTCCAGGGGCAGGG - Intronic
1019747615 7:2709458-2709480 CTTTCAGGGCCCCAGGGGAAAGG - Intronic
1021526450 7:21593878-21593900 GTCTGGGGGGAGCAGGGGCAGGG - Intronic
1021877315 7:25060691-25060713 GGCTCAGGCCACCAGGAGAATGG + Intergenic
1022023456 7:26423566-26423588 GTCTCAAGGCACCAGAAGCCAGG - Intergenic
1022040526 7:26577240-26577262 GTCACAGGCCACCTTGGGCAAGG - Intergenic
1022509537 7:30926257-30926279 GTCTCAGGGAGCCAGGGGCTAGG + Intergenic
1023177612 7:37448684-37448706 GTCGCAGGACAGCAGCGGCAAGG + Exonic
1025106587 7:56175627-56175649 CGCTCAGGGCTGCAGGGGCATGG - Intergenic
1025203778 7:56979649-56979671 GTCTTATGGCACCTGGGGCCAGG - Intergenic
1025668163 7:63597281-63597303 GTCTTATGGCACCTGGGGCCAGG + Intergenic
1028338035 7:89681946-89681968 CTCTCAGGGCACCATGGGAAAGG - Intergenic
1030820772 7:114087845-114087867 CTCTTAGGGCACCTGGCGCATGG + Intronic
1035024990 7:155819360-155819382 GGCTCTGGGCTCCAGGGGCCTGG + Intergenic
1035204821 7:157288431-157288453 GTCTCAGGGGAGCAGAGGGATGG + Intergenic
1035272319 7:157727848-157727870 GACTCAGGGGTCCAAGGGCAGGG - Intronic
1036015310 8:4776504-4776526 GTCTCAGGGCCCCATAGGAATGG + Intronic
1036364245 8:8104924-8104946 GTTTCAGGTCACTAGGGTCAGGG - Intergenic
1036594391 8:10199252-10199274 GTCTCAGGGAATAGGGGGCATGG + Intronic
1037150029 8:15626102-15626124 GACACAGGGCACAGGGGGCACGG - Intronic
1040385028 8:46909327-46909349 GCCTCAGGGCACCAGCAGGAGGG + Intergenic
1040439603 8:47427636-47427658 GTCTCTGTGCACCAGATGCAGGG + Intronic
1040877466 8:52168122-52168144 GTCCCACGGCACTTGGGGCACGG + Intronic
1041454469 8:58042957-58042979 CTCTCATAGCACCAGGAGCAGGG + Intronic
1043474953 8:80597038-80597060 GTTTCAGAGCTCCAGGGGGAAGG + Intergenic
1045795103 8:106033725-106033747 GTCTCAGAACACCAGGGCAATGG - Intergenic
1046285911 8:112092604-112092626 GCCTTAGGGCAGAAGGGGCAGGG + Intergenic
1047191339 8:122681626-122681648 GTCTCTGGGCACCAGGAGGCTGG - Intergenic
1047808322 8:128381354-128381376 GCCTGGGGGCACCATGGGCAAGG + Intergenic
1048330527 8:133467662-133467684 TACTCCGGGCCCCAGGGGCAAGG + Intronic
1048904037 8:139069685-139069707 AGCTCAGGGCAACAGAGGCAAGG + Intergenic
1048906667 8:139095675-139095697 CTCACTGGGCATCAGGGGCAAGG + Intergenic
1049547536 8:143240498-143240520 GGCACAGGGCACCAGGGCGATGG + Intergenic
1049567533 8:143348830-143348852 GCCTCAGGGCACCAGGCTCCTGG - Intronic
1049619357 8:143591043-143591065 GTCTCAGTGCTCCAGGCGCTTGG - Intronic
1053350855 9:37412427-37412449 GTCTTCGGGCACCAGGAACAGGG - Intergenic
1053779986 9:41597880-41597902 GTCTGAAGGCCCCAGGGGGAGGG - Intergenic
1053803202 9:41777045-41777067 GTCTCAGGGGAGCAGAGGGATGG + Intergenic
1054142059 9:61538079-61538101 GTCTCAGGGGAGCAGAGGGATGG - Intergenic
1054167943 9:61808123-61808145 GTCTGAAGGCCCCAGGGGGAGGG - Intergenic
1054191494 9:61988355-61988377 GTCTCAGGGGAGCAGAGGGATGG + Intergenic
1054646875 9:67599357-67599379 GTCTCAGGGGAGCAGAGGGATGG - Intergenic
1054669603 9:67772781-67772803 GTCTGAAGGCCCCAGGGGGAGGG + Intergenic
1057366973 9:94431905-94431927 GTCTCAGGTGACCAAAGGCATGG - Intronic
1057656360 9:96956164-96956186 GTCTCAGGTGACCAAAGGCATGG + Intronic
1057727320 9:97577128-97577150 GTCTCTGGGCAGCAGAGCCAGGG - Intronic
1059657572 9:116369990-116370012 CTCTCACCGCACAAGGGGCAAGG - Intronic
1060298033 9:122356253-122356275 TTCTGAGAGCACCAGGGGGAAGG - Intergenic
1060540453 9:124426524-124426546 TTCTCAGGGCATCACGGGAAGGG + Intergenic
1060660677 9:125403412-125403434 GACTCAAGCCAACAGGGGCAAGG - Intergenic
1060993469 9:127862178-127862200 GTCGCACAGCAGCAGGGGCAGGG - Intergenic
1061296339 9:129678937-129678959 GTCTCACGGCAGCTGGGCCAGGG - Intronic
1061482415 9:130903544-130903566 TTCTCTGGGCACCAGGGAAACGG + Exonic
1062106417 9:134757394-134757416 GTCCCAGGCCACGGGGGGCAGGG + Intronic
1062626997 9:137447931-137447953 GCCTGAGGGCACCAGGGAGAGGG - Exonic
1062637796 9:137500635-137500657 GTCTCAGGGCAGGGGGGGCTGGG + Intronic
1185608588 X:1380864-1380886 GTGTCAGGGCCTCAGGGGCCGGG + Intronic
1188162730 X:26822302-26822324 GGCTCAGGCAACGAGGGGCAGGG + Intergenic
1189668678 X:43384630-43384652 CTCACATGGCACAAGGGGCAAGG - Intergenic
1192232794 X:69277693-69277715 CTCTCTGAGCTCCAGGGGCATGG - Intergenic
1193444004 X:81577510-81577532 GTCTGAGGGCAGCAGGGGTGGGG - Intergenic
1193513258 X:82432516-82432538 GTCTAGAGGCCCCAGGGGCAGGG - Intergenic
1193579447 X:83246043-83246065 GTCTAATGGCATCAGGGACATGG - Intergenic
1193668455 X:84353424-84353446 CTCTCATGGCAGAAGGGGCAAGG - Intronic
1196098309 X:111823238-111823260 GTCTCAAACCACCAGGGGGAGGG + Intronic
1196131158 X:112157994-112158016 GCCTCAGGGAGCCAGGGACAGGG - Intergenic
1198713606 X:139532526-139532548 GTGTCAGGGTACTAGGGGTATGG + Intronic
1198932743 X:141878838-141878860 GTCTCTGGACAGCAGGGGAAGGG + Intronic
1200137296 X:153881381-153881403 TTCCCAGGGAACCAGGGGCCTGG + Intronic
1200961642 Y:9001425-9001447 GTCTCAGGGCACCAGGCCTGAGG + Intergenic