ID: 1134684461

View in Genome Browser
Species Human (GRCh38)
Location 16:16148936-16148958
Sequence GCTCCAAGGACACAAAAACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 174}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134684461_1134684467 -7 Left 1134684461 16:16148936-16148958 CCTGGTTTTTGTGTCCTTGGAGC 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1134684467 16:16148952-16148974 TTGGAGCTCATCTCTGGTGGGGG 0: 1
1: 0
2: 1
3: 10
4: 156
1134684461_1134684470 8 Left 1134684461 16:16148936-16148958 CCTGGTTTTTGTGTCCTTGGAGC 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1134684470 16:16148967-16148989 GGTGGGGGAGGAGGAGCAGCAGG 0: 1
1: 0
2: 44
3: 622
4: 5985
1134684461_1134684472 19 Left 1134684461 16:16148936-16148958 CCTGGTTTTTGTGTCCTTGGAGC 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1134684472 16:16148978-16149000 AGGAGCAGCAGGAGATGCGAGGG 0: 1
1: 0
2: 7
3: 70
4: 523
1134684461_1134684466 -8 Left 1134684461 16:16148936-16148958 CCTGGTTTTTGTGTCCTTGGAGC 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1134684466 16:16148951-16148973 CTTGGAGCTCATCTCTGGTGGGG 0: 1
1: 0
2: 3
3: 14
4: 158
1134684461_1134684465 -9 Left 1134684461 16:16148936-16148958 CCTGGTTTTTGTGTCCTTGGAGC 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1134684465 16:16148950-16148972 CCTTGGAGCTCATCTCTGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1134684461_1134684468 -4 Left 1134684461 16:16148936-16148958 CCTGGTTTTTGTGTCCTTGGAGC 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1134684468 16:16148955-16148977 GAGCTCATCTCTGGTGGGGGAGG 0: 1
1: 0
2: 3
3: 14
4: 253
1134684461_1134684463 -10 Left 1134684461 16:16148936-16148958 CCTGGTTTTTGTGTCCTTGGAGC 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1134684463 16:16148949-16148971 TCCTTGGAGCTCATCTCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 159
1134684461_1134684471 18 Left 1134684461 16:16148936-16148958 CCTGGTTTTTGTGTCCTTGGAGC 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1134684471 16:16148977-16148999 GAGGAGCAGCAGGAGATGCGAGG 0: 1
1: 0
2: 8
3: 64
4: 601
1134684461_1134684469 -1 Left 1134684461 16:16148936-16148958 CCTGGTTTTTGTGTCCTTGGAGC 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1134684469 16:16148958-16148980 CTCATCTCTGGTGGGGGAGGAGG 0: 1
1: 0
2: 4
3: 51
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134684461 Original CRISPR GCTCCAAGGACACAAAAACC AGG (reversed) Exonic
900157866 1:1210811-1210833 CCTCCAAGGACACAGAGCCCCGG + Intergenic
903228055 1:21904882-21904904 GCTTCAAGGGCACACCAACCTGG + Intronic
905236617 1:36554410-36554432 CCTCCAAGGAGCCAGAAACCTGG + Intergenic
905258676 1:36702137-36702159 GCTTCAAAGTCAGAAAAACCTGG + Intergenic
906147522 1:43568858-43568880 GCTCTAAAGACACAAAAAGTTGG - Intronic
910164410 1:84309327-84309349 GCAGCAACGACACAAGAACCAGG - Intronic
912521975 1:110251873-110251895 GGACCAAGGACAGAAACACCGGG - Intronic
915169786 1:153969561-153969583 GGCCCAATGCCACAAAAACCGGG - Intronic
915543144 1:156581561-156581583 CCTCCAAGGCCCCACAAACCAGG + Exonic
917963878 1:180166469-180166491 GCTGAAAGGACAAAAAACCCAGG - Exonic
918131185 1:181631073-181631095 TCTCCAAGAACAAACAAACCTGG + Intronic
918820567 1:189249754-189249776 GCCCCAAGCACACACACACCTGG - Intergenic
922561194 1:226570779-226570801 GGTCCAATGGCACAAAAACAAGG - Intronic
923033475 1:230267805-230267827 GCTACAAGGACACAGAAGCATGG - Intronic
1062898372 10:1122369-1122391 TCTCCCAGGGCACAAAAACTGGG - Intronic
1062994952 10:1857063-1857085 GCTCCATGGCCACATAGACCAGG + Intergenic
1063215299 10:3919801-3919823 TCTTCAAGGACAGAAAATCCTGG + Intergenic
1063442363 10:6083259-6083281 TCTCCAAGGTCATAAATACCTGG - Intergenic
1065125630 10:22570918-22570940 GCTCACAAGTCACAAAAACCAGG - Intronic
1065571833 10:27079250-27079272 CCTCCAAAAAAACAAAAACCTGG + Intronic
1068615770 10:59114346-59114368 GCTGCAAAGAAACAAAATCCTGG - Intergenic
1069900379 10:71703380-71703402 GCTCCAAGTACACAGCACCCTGG - Intronic
1069954068 10:72039164-72039186 GCTCTGAGGAGACAAAAACAAGG - Intergenic
1071238707 10:83679888-83679910 GATCAAAGGACACAAAAACATGG - Intergenic
1071452063 10:85805174-85805196 GTTCACAGGATACAAAAACCTGG + Intronic
1071709324 10:88034005-88034027 GATGCAAGGATACAAAAGCCGGG - Intergenic
1073601772 10:104852990-104853012 GATCAGAGGACACAAAAACTGGG + Intronic
1076372433 10:129964142-129964164 GCTCCAAAGACAAATAAACGGGG + Intergenic
1078412456 11:11137468-11137490 GCTCAAAGGACTCAGGAACCTGG - Intergenic
1078427614 11:11264720-11264742 GCTCCAAAGACACAAACCCTTGG - Intergenic
1078708822 11:13770592-13770614 GCCAAAAAGACACAAAAACCAGG - Intergenic
1079446873 11:20565276-20565298 GCTCAAAGGACAAAATATCCAGG + Intergenic
1083476983 11:62921281-62921303 TCTCCAGGGACCCAAACACCTGG + Exonic
1089054775 11:115576711-115576733 ACCTCAAGGACACAAAAACCTGG + Intergenic
1091030502 11:132183230-132183252 TCTTCAAGGACCCAGAAACCTGG + Intronic
1091237737 11:134033157-134033179 GCTCCTCTGACCCAAAAACCAGG - Intergenic
1091554455 12:1561811-1561833 GCTCCAAGGAGACAGATGCCAGG + Intronic
1095525986 12:43126359-43126381 GCTCCATGGACCTAAAACCCAGG - Intergenic
1095806804 12:46328436-46328458 CTTCCAAGGAAACAAAACCCTGG - Intergenic
1099620679 12:84999201-84999223 GCTAAAAGGACACAGAAATCAGG - Intergenic
1100793106 12:98152259-98152281 GCTCCAGGGACACAAAAATCTGG + Intergenic
1101852338 12:108413944-108413966 GCACCAAAAACACAAAAATCTGG - Intergenic
1101900148 12:108786017-108786039 ACTCCAAGGAGACAAAGTCCTGG + Exonic
1102575259 12:113852232-113852254 GCTCCAGGGACACAATTAGCAGG + Intronic
1103918220 12:124386704-124386726 GTTTCAAGGCCACAAACACCAGG + Intronic
1104445096 12:128826126-128826148 GTTCCAAGGCCATAAAAACGGGG - Intergenic
1107559889 13:41549590-41549612 CACCCAAGGACACCAAAACCAGG + Intergenic
1109284217 13:60393279-60393301 GGTCCAAGAAAACAAAAACGAGG - Intergenic
1110870616 13:80448775-80448797 GCTGCTAGGAAACAAAAATCTGG + Intergenic
1113231287 13:108216223-108216245 GCTCCTGGAACACAAAAACTGGG - Intronic
1120162554 14:81161455-81161477 GCTGAAAGGACAGAAAAAACAGG - Intergenic
1120814653 14:88842745-88842767 GGGCCAAAGACAGAAAAACCTGG - Intronic
1120999360 14:90440416-90440438 TCTCCAAAGGCATAAAAACCAGG - Intergenic
1122398846 14:101455218-101455240 GCACCCAGCACACAGAAACCAGG - Intergenic
1123430004 15:20206600-20206622 GCTCAAAGTGCACATAAACCTGG - Intergenic
1125595269 15:40881416-40881438 CCTCCAAGGACACAAGCACATGG - Intergenic
1127676472 15:61243988-61244010 GTTCTAGGGACAGAAAAACCTGG + Intergenic
1127817988 15:62629263-62629285 CATCCAAGGTCACAAAAAGCTGG - Intronic
1127930064 15:63589602-63589624 ACTCCAAGGAGAAAAAAGCCAGG - Intronic
1128914793 15:71549950-71549972 GGTCCAAGGACAGAACAACCTGG + Intronic
1129504398 15:76069299-76069321 GATCAAAGGACAGAAAAAGCAGG + Intronic
1131423067 15:92323362-92323384 GCACCAGGGAAACAAAAAACAGG + Intergenic
1132495644 16:262023-262045 GCTGCAAGGACACAAGGCCCAGG - Intronic
1132943143 16:2518408-2518430 GCTCCAAGCACACAGGAGCCTGG - Intronic
1134329805 16:13240178-13240200 GCTCCATTTACACAAAAAACTGG - Exonic
1134684461 16:16148936-16148958 GCTCCAAGGACACAAAAACCAGG - Exonic
1135618493 16:23932776-23932798 GTTACAAGGAAACAGAAACCAGG - Intronic
1136273271 16:29161364-29161386 ACTCCATGGACACGAAACCCTGG - Intergenic
1136854632 16:33644619-33644641 GCTCAAAGTGCACATAAACCTGG + Intergenic
1138824920 16:60307584-60307606 GCTCTCAGTACACATAAACCTGG - Intergenic
1139138570 16:64233893-64233915 GCTCCAAGGACACCCAAAGTGGG - Intergenic
1139972955 16:70787552-70787574 GCCCCATGGACACAAAGGCCAGG + Intronic
1141932344 16:87214377-87214399 GATCCACAGACACAAAAATCTGG + Intronic
1142076824 16:88123230-88123252 ACTCCATGGACACGAAACCCTGG - Intergenic
1203116208 16_KI270728v1_random:1493088-1493110 GCTCAAAGTGCACATAAACCTGG + Intergenic
1144071107 17:11671872-11671894 GATCCAAGGACACAAAAGTCAGG - Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1147502693 17:40980784-40980806 GCTCCAAGCACAGCAAAGCCTGG - Exonic
1149532289 17:57405057-57405079 TCTCCAAGGACAGACAACCCCGG - Intronic
1149643281 17:58219100-58219122 GATCTAAGGACACAAAAGCATGG + Intronic
1149947979 17:60952174-60952196 GCAACAAGAACACAAAAAGCAGG - Intronic
1151363424 17:73602168-73602190 ACTCCAAGGTCACAAAAACAAGG + Intronic
1152570115 17:81117989-81118011 GCTCACAGGACACTTAAACCAGG - Exonic
1152756531 17:82089360-82089382 GCTCCACGAACTCAAACACCGGG + Exonic
1153741933 18:8138396-8138418 GTTCCAAGGACACAGAAGACAGG - Intronic
1155109723 18:22702248-22702270 GGTCCTAGGACACAAAACACTGG - Intergenic
1156619352 18:38830672-38830694 GATGCAAGGACACAAAAATGGGG + Intergenic
1159292379 18:66439692-66439714 GCCCCAAGCACACACACACCCGG - Intergenic
1159594931 18:70373747-70373769 TCTACCAGGAGACAAAAACCAGG - Intergenic
1162376475 19:10308367-10308389 ATTCCAAGGACACACAGACCAGG - Exonic
1163229346 19:15989728-15989750 GCTGCTAGGACAGAAAGACCTGG - Intergenic
1166677756 19:44749645-44749667 GCTCCAGGGACCCAGATACCAGG + Intronic
1167080995 19:47275899-47275921 GCTCCAAGCACACAAAAAACTGG - Intergenic
925151542 2:1618675-1618697 CCTCCAAGGACACAGAAGTCAGG - Intergenic
926754558 2:16224887-16224909 GCACCAAAGACACAAAACCCAGG - Intergenic
929696917 2:44125350-44125372 GACCCAAAGTCACAAAAACCTGG + Intergenic
930307192 2:49689583-49689605 GTTCCATGGAAATAAAAACCTGG - Intergenic
932706846 2:74032564-74032586 GCTGCCAGCACACAAGAACCAGG - Intronic
932897726 2:75658887-75658909 GCTCCAAAGACACAAATACATGG - Intronic
936587962 2:113775290-113775312 GCTCCAAGGAGACATTAACGAGG + Intergenic
936893165 2:117395757-117395779 GCTCCAAGGAGATAATGACCTGG + Intergenic
941929273 2:170924441-170924463 GCCCCAAGGATACACACACCTGG + Intergenic
944201585 2:197113265-197113287 GTTCCAAGGACTGAAACACCTGG + Intronic
946338488 2:219054308-219054330 CCTCCAAGGACAAAAACTCCAGG - Intergenic
948682056 2:239641889-239641911 GCTCCAGGGTCACACACACCAGG - Intergenic
1172701644 20:36856781-36856803 GCTCCAGGGAGACACAGACCAGG + Intronic
1175916955 20:62430462-62430484 GCTCCAGTAACACAAATACCAGG - Intergenic
1176365919 21:6032785-6032807 TCTCCAGGGACACGCAAACCTGG + Intergenic
1179757597 21:43505760-43505782 TCTCCAGGGACACGCAAACCTGG - Intergenic
1180920511 22:19519308-19519330 GAGCCAAGCACACAAAAGCCCGG - Intronic
1181582038 22:23833935-23833957 ACTCCAGGGACCCCAAAACCTGG - Intronic
1182675254 22:32034253-32034275 ATTCCAGGAACACAAAAACCAGG - Intergenic
1185366786 22:50440495-50440517 GCCCAAAGGACCCCAAAACCGGG - Intronic
949845842 3:8369787-8369809 GTTCCAATGAAACCAAAACCAGG - Intergenic
950615866 3:14157773-14157795 GCTCCAAAGCCACACAGACCTGG + Intronic
951063060 3:18233235-18233257 GCTACAAAGACAAAAGAACCAGG + Intronic
954489147 3:50885201-50885223 GCTACAAAGCCACAAAAACATGG - Intronic
959078717 3:101778525-101778547 GCTCCAAGCACAGAGAAACACGG + Intergenic
962913073 3:139872842-139872864 GATCCAAGGACACAGAAATCTGG - Intergenic
964837029 3:160950423-160950445 GCTCTCAGGACAGAAAGACCAGG + Intronic
965165205 3:165188474-165188496 GGTCCAGGGACACAACCACCGGG - Exonic
967799578 3:193641323-193641345 GCTCTAGGGAAACAAAAAACTGG - Intronic
967989580 3:195121082-195121104 GCTCCCAGGGCCCAAACACCCGG + Intronic
968395936 4:238580-238602 GATGCAAGGACATAAAAACAAGG - Intergenic
971529421 4:27666305-27666327 TCTCCAAGAAAACAAAAACATGG - Intergenic
972289281 4:37676637-37676659 GCTCCAAAGGCAGAAAAATCTGG - Intronic
972703367 4:41515726-41515748 GCTCCAGAGACAGAAAGACCTGG - Intronic
973715369 4:53670647-53670669 GGTCCAAAGGCCCAAAAACCAGG - Intronic
975598543 4:76074798-76074820 CCTCCAAAGGCACAAAAGCCAGG + Exonic
976443784 4:85107486-85107508 GCTCCATGAACAGAAAAACCAGG + Intergenic
976488791 4:85642133-85642155 GCTCCCAAGACAGAAAAACAGGG + Intronic
977791328 4:101107073-101107095 GCCCCAAGAACAAAAAAACAAGG + Intronic
978131402 4:105202077-105202099 TTTCCAAGGACATAAAAACCTGG - Intronic
978538378 4:109787389-109787411 GCTCCAAGGAGAGAAAAAAGTGG - Intronic
979396512 4:120196148-120196170 ACTCCAAAGACAGAAGAACCTGG - Intergenic
979731889 4:124033803-124033825 GCTTCAATGCAACAAAAACCTGG + Intergenic
981026473 4:140082003-140082025 CCACCAATGACACAAAAACAGGG + Intronic
984457094 4:179984055-179984077 GCTACAAGAAGTCAAAAACCCGG + Intergenic
986607790 5:9539516-9539538 CCTCCAAGCACACAAATTCCAGG - Intronic
989030407 5:37112889-37112911 ACTTCAAGAACACAAAACCCTGG + Intronic
991047234 5:62235557-62235579 GCTCAAAGTGCACATAAACCTGG - Intergenic
992754425 5:79890761-79890783 CCTCCATGGAAACAAAAACATGG - Intergenic
993326500 5:86545036-86545058 GCTCTTTGGACACAAAAAGCAGG + Intergenic
994265232 5:97708014-97708036 TCTCCAAGTAAAGAAAAACCTGG + Intergenic
995651021 5:114368421-114368443 GCACCAAGGCCACAGAAAACAGG + Intronic
996388780 5:122937837-122937859 GCTCCAAAGAGAAACAAACCTGG + Intronic
996457886 5:123705907-123705929 GCTGCAAGGAACAAAAAACCTGG + Intergenic
996532935 5:124545085-124545107 GTTCCTAGGACCCAAAACCCAGG + Intergenic
997637877 5:135427948-135427970 TCTCAGAGCACACAAAAACCTGG - Intergenic
998872187 5:146563515-146563537 TGTCCAAGGGTACAAAAACCAGG - Intergenic
1000012308 5:157244325-157244347 GCTCCATGAACTCAAACACCAGG - Exonic
1000355010 5:160385949-160385971 CCTCCAGGGACACAAAAACTTGG + Intergenic
1008639060 6:53443023-53443045 GCTCCTTTGACACAAAAACCTGG - Intergenic
1010640114 6:78315133-78315155 CCTGAAAGGACACAAAACCCAGG + Intergenic
1012716038 6:102671896-102671918 CCTCCAAGGAGGCAAAAATCAGG - Intergenic
1013564150 6:111340474-111340496 GCTTCCAGGAGACAAAAATCTGG + Intronic
1017680638 6:156860949-156860971 TCTCTAATGACACAAAAACTTGG + Intronic
1018184678 6:161256241-161256263 GCTGGAAGGATACGAAAACCTGG + Intronic
1018651902 6:165999184-165999206 TCTCCAATCACACAAACACCTGG + Intergenic
1019553454 7:1616563-1616585 GCTCACAGGACACAGAAAGCAGG - Intergenic
1020463613 7:8451486-8451508 GTTCCAAAGACAGAAAAACTTGG - Intronic
1022109020 7:27216597-27216619 GCTCCTAGAACACAAAACCCTGG - Intergenic
1022110691 7:27229176-27229198 GCAAAAAGGACACAAAATCCTGG + Intergenic
1022356592 7:29620771-29620793 GCTCTAAGCACACAAGGACCAGG - Intergenic
1023165418 7:37338574-37338596 GCTCCAAGGACATTTAAACCTGG - Intronic
1023788286 7:43729854-43729876 CCTCCAAGGACACGAAGCCCCGG + Intergenic
1024994514 7:55261635-55261657 TCTCCATGGACACAGACACCAGG + Intergenic
1025144639 7:56493098-56493120 ACTCCAAGGACCCAGATACCTGG - Intergenic
1025912532 7:65839973-65839995 GCTGCCAGGACACAAAAGCTGGG - Intergenic
1026904144 7:74053237-74053259 GCTCCTGGGACACCAACACCTGG - Exonic
1029236005 7:99119663-99119685 TCTCCAGGGACAGGAAAACCTGG + Intronic
1029616892 7:101664828-101664850 GATCCCAGGAAAAAAAAACCCGG - Intergenic
1030961799 7:115932180-115932202 GCTCTTAGTACACAAAACCCAGG - Intergenic
1032706853 7:134427513-134427535 GTTCCAAGGACAAAAGACCCCGG - Intergenic
1034433595 7:151052654-151052676 GCTCCGAGGACACAGACAGCAGG - Exonic
1037231633 8:16665517-16665539 GCTCAAAGGAGACAAAAAAGTGG + Intergenic
1038191522 8:25325441-25325463 GCTTCAAGCATCCAAAAACCTGG + Exonic
1040618988 8:49068275-49068297 GATTCAAAGACACAAAAACTAGG + Intronic
1042735381 8:71982016-71982038 CCTCCAAAGACATAAAAACTTGG - Intronic
1043875355 8:85479872-85479894 TCTCCAAATACACAAAAACACGG - Intronic
1044080614 8:87878010-87878032 GCTGCAGGGAAAAAAAAACCTGG + Intergenic
1045070857 8:98503116-98503138 GCTCCCAAGACCAAAAAACCAGG - Intronic
1049576076 8:143390309-143390331 GCCCCACGGTCACTAAAACCAGG - Intergenic
1056106212 9:83349178-83349200 GGTCCAAGGACTCAAAAATTCGG + Intronic
1056548307 9:87631067-87631089 GCTCCTAGGTCACAAAGCCCTGG - Intronic
1185578480 X:1192326-1192348 ACACATAGGACACAAAAACCAGG + Intronic
1185682115 X:1897344-1897366 TCTGCAAGGACACACAACCCAGG + Intergenic
1191246513 X:58232523-58232545 ACTCTAAGGACAGAAACACCTGG + Intergenic
1191984722 X:66967694-66967716 GCTCTGAGGAAATAAAAACCTGG - Intergenic
1196001036 X:110786435-110786457 GCTCCAAGTACACAAAACCAGGG + Intronic
1197116824 X:122843605-122843627 GCTCCAAGGACACAAACCGAAGG + Intergenic
1199569939 X:149257148-149257170 GGTCCAAGGAGGCAAAAGCCAGG + Intergenic