ID: 1134684643

View in Genome Browser
Species Human (GRCh38)
Location 16:16150171-16150193
Sequence GGCCCTTCTGGGCCAGCAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 373}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134684633_1134684643 21 Left 1134684633 16:16150127-16150149 CCTGGCTCAGACCAGGCCTGACT 0: 1
1: 0
2: 1
3: 27
4: 240
Right 1134684643 16:16150171-16150193 GGCCCTTCTGGGCCAGCAGCTGG 0: 1
1: 0
2: 6
3: 43
4: 373
1134684637_1134684643 5 Left 1134684637 16:16150143-16150165 CCTGACTCCTGGGCCAGTCTGTA 0: 1
1: 0
2: 1
3: 21
4: 180
Right 1134684643 16:16150171-16150193 GGCCCTTCTGGGCCAGCAGCTGG 0: 1
1: 0
2: 6
3: 43
4: 373
1134684638_1134684643 -2 Left 1134684638 16:16150150-16150172 CCTGGGCCAGTCTGTAAAACAGG 0: 1
1: 0
2: 1
3: 12
4: 172
Right 1134684643 16:16150171-16150193 GGCCCTTCTGGGCCAGCAGCTGG 0: 1
1: 0
2: 6
3: 43
4: 373
1134684636_1134684643 10 Left 1134684636 16:16150138-16150160 CCAGGCCTGACTCCTGGGCCAGT 0: 1
1: 0
2: 0
3: 27
4: 377
Right 1134684643 16:16150171-16150193 GGCCCTTCTGGGCCAGCAGCTGG 0: 1
1: 0
2: 6
3: 43
4: 373
1134684640_1134684643 -8 Left 1134684640 16:16150156-16150178 CCAGTCTGTAAAACAGGCCCTTC 0: 1
1: 0
2: 4
3: 22
4: 113
Right 1134684643 16:16150171-16150193 GGCCCTTCTGGGCCAGCAGCTGG 0: 1
1: 0
2: 6
3: 43
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134684643 Original CRISPR GGCCCTTCTGGGCCAGCAGC TGG Exonic
900806239 1:4769954-4769976 GGCCCTTCTGGCCCAGAAATGGG + Intronic
901210282 1:7520630-7520652 GCCCCTTCTGGGCACCCAGCTGG + Intronic
901497601 1:9630851-9630873 CTCCCTGCTGGGCCAGGAGCCGG - Intergenic
901814855 1:11788200-11788222 GACCCTTCAGGGCCAGAAGGAGG - Exonic
901818143 1:11806428-11806450 GGCCAATCTGGGCCCGCAGGTGG + Intronic
902188685 1:14744951-14744973 GGCGGTTCTGGGTCAGCTGCAGG - Intronic
902191831 1:14769134-14769156 AGCCCATCAAGGCCAGCAGCAGG + Intronic
902218701 1:14950848-14950870 TTCCTTTCTGGGCCTGCAGCTGG - Intronic
902466838 1:16623876-16623898 GGGTCTCCTTGGCCAGCAGCAGG + Intergenic
902507764 1:16948898-16948920 GGGTCTCCTTGGCCAGCAGCAGG - Exonic
902608578 1:17583310-17583332 TGCCCTTCTCACCCAGCAGCAGG + Intronic
902944572 1:19825529-19825551 GGCACTGCTGGGCCTGCAGGTGG + Intergenic
903063302 1:20684819-20684841 GCCCGTTGTGGACCAGCAGCAGG - Exonic
903142496 1:21347373-21347395 GGCCACTCTGGGTCAGCACCTGG - Intergenic
903180658 1:21603342-21603364 GGAGGTTCTGGCCCAGCAGCTGG + Intronic
903237178 1:21957558-21957580 GGCTCTTGTGGGCCAGCACACGG - Intergenic
903486314 1:23691763-23691785 GGGCCTTATGGGCCAGGAGGCGG - Exonic
903858585 1:26351909-26351931 GCCTCTCCTGGGCCAGCAGAAGG + Intronic
904002225 1:27345328-27345350 GGCCCCTCTGGGGCATCAGCTGG - Exonic
904206826 1:28860965-28860987 GGCCCATCTGGTCCAGCCCCAGG - Intronic
904373227 1:30063934-30063956 GCCACTTCTGTGCCAGCATCAGG - Intergenic
904380148 1:30105097-30105119 GGGCCTCCTCGGCCAGCAGATGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
904673380 1:32182273-32182295 GGCCCTTCTGGGGAGGCAGAGGG + Intronic
904802332 1:33102494-33102516 GGCTCTTCTGTCCCAGCAGCTGG + Intronic
904835993 1:33336728-33336750 GTCCCTCCTGAACCAGCAGCTGG - Intronic
905167963 1:36094248-36094270 GGCCCAGCTGGGCCAGGAACAGG + Intergenic
906322940 1:44827950-44827972 GGACCTTCTAGGCCAGGAGGAGG - Exonic
911070798 1:93830504-93830526 GGAGCTTCTGAGCCAGGAGCAGG - Intronic
911079708 1:93916439-93916461 GGACCTGCTGAGCCAGGAGCGGG + Intergenic
912950739 1:114118621-114118643 GGCCCCTCTGCAGCAGCAGCAGG - Intronic
913152999 1:116064361-116064383 GACCCTTGGGGGGCAGCAGCGGG - Intronic
914751035 1:150535066-150535088 GGGCCTCCTGGGCCAGCACTTGG + Intergenic
915145179 1:153792662-153792684 GGCCCCTCTGGGGAAGCAGCGGG + Intergenic
915512715 1:156395177-156395199 GGCCCAGCTGGCCCAGCAGGAGG + Intergenic
916843355 1:168623421-168623443 GGCTCTTCTCTGCCACCAGCTGG + Intergenic
918321456 1:183369046-183369068 GGCAACTCTGAGCCAGCAGCAGG + Intronic
919854756 1:201697653-201697675 GCCTCTTCTGGGCTTGCAGCAGG + Intronic
919916776 1:202144115-202144137 GGCCCGTCTCAGCCGGCAGCGGG + Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
921047112 1:211485401-211485423 GAGCCTTCTGGGGGAGCAGCTGG - Intronic
921887020 1:220317278-220317300 GCACCTTGTTGGCCAGCAGCAGG + Intergenic
922915376 1:229253022-229253044 GGGCCTGCAGGGACAGCAGCCGG - Intergenic
924757152 1:246951760-246951782 GGCCCAGCTGTGCCAGCACCTGG - Intronic
1065223640 10:23521195-23521217 GACCCTTCTGGGCCTGGAGATGG - Intergenic
1066651568 10:37661134-37661156 GTTCCTTCAGGGCCAGCTGCTGG - Intergenic
1069661100 10:70123979-70124001 GGACGTTCAGGGCCTGCAGCTGG + Exonic
1069995167 10:72337332-72337354 GACCCTTCTCAGCCAGCAGGGGG - Intronic
1070262033 10:74866033-74866055 GGTTCTTCAGGGCCAGCTGCAGG + Intronic
1070533996 10:77361777-77361799 GACTCTTCTGGGCCAGCCACGGG - Intronic
1071824971 10:89316421-89316443 GGACCCTCTGAGCCAGGAGCAGG - Intronic
1072654279 10:97319576-97319598 CGCCGATCTGGGCCACCAGCCGG - Exonic
1072656606 10:97334428-97334450 CGCCGATCTGGGCCACCAGCCGG + Exonic
1073036170 10:100565487-100565509 GGCCCTCCTGGGCCAGGCTCTGG - Intergenic
1073432283 10:103494258-103494280 GGCCCTGCTGGGGCTGCAGCCGG - Exonic
1074000496 10:109367577-109367599 GGACCCTCTGAGCCAGGAGCAGG - Intergenic
1074377547 10:112951741-112951763 GGGCCTCCTGGGCCACGAGCGGG - Intronic
1074638179 10:115345101-115345123 GGACCTGCTGGGACAGCAGAGGG - Intronic
1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG + Intronic
1075545063 10:123348892-123348914 GGCCCATCTGAGACAGCAGAGGG - Intergenic
1075724471 10:124604388-124604410 GGCCGTGCTGGGCCAGCACGTGG + Intronic
1075911558 10:126129445-126129467 GGTTCCTCTGGGCCAGGAGCTGG + Intronic
1075990662 10:126836194-126836216 TACCATTCTGGGCCACCAGCAGG + Intergenic
1076764169 10:132624058-132624080 GGATCTGCAGGGCCAGCAGCAGG - Intronic
1076875865 10:133215227-133215249 GCCCACTCTGGGACAGCAGCAGG - Intronic
1076878904 10:133230585-133230607 GGCCGCGCTGGCCCAGCAGCAGG + Exonic
1077352295 11:2098607-2098629 GGCCCTTCTGGGCTGGGTGCAGG + Intergenic
1077365231 11:2158893-2158915 GGCCCTTCTGGGTGAGCAGCAGG + Intronic
1078609737 11:12809899-12809921 GGCCTTTCTGGACCAGCCGATGG + Intronic
1078659887 11:13278059-13278081 GGCCCTTTAAGGCCGGCAGCGGG - Intronic
1079133036 11:17760616-17760638 GACCTTTCTTGGCCACCAGCAGG - Intronic
1080211771 11:29794799-29794821 GGACCTTCTGAGCCAGGTGCGGG - Intergenic
1083282684 11:61636979-61637001 GCACCTTATTGGCCAGCAGCAGG - Intergenic
1083723942 11:64618787-64618809 GGCCTTTCTGGCCCAGCAGCTGG + Intronic
1083742294 11:64717340-64717362 GGCGGCTCTGGGCCAGCAGTGGG - Intronic
1083780309 11:64914162-64914184 GACACTCCTGGGCCAGCTGCAGG + Exonic
1083994185 11:66264093-66264115 GGCCCTGCTGTGCCAGAACCAGG + Exonic
1084033107 11:66492547-66492569 GGCCCTACTGGGTCAGGACCTGG - Intronic
1084665447 11:70573877-70573899 GGCCTTTCAGGGCCCCCAGCGGG - Intronic
1084904382 11:72334679-72334701 GCCCCTTCGGGCCAAGCAGCTGG + Intronic
1084913000 11:72406358-72406380 GGCCCTTCAGGGGCAGTAGGAGG - Intronic
1085412082 11:76297344-76297366 GGCCCCCCTGGCCCAGCAGAGGG - Intergenic
1087612577 11:100452197-100452219 GGACCTTCTGAGCCAGGTGCGGG - Intergenic
1088650990 11:111958158-111958180 TGCTCTTGTGGGCCAGAAGCAGG + Intronic
1088914719 11:114218502-114218524 GGCACTTCGGGACCAGCTGCTGG + Intronic
1089329840 11:117681510-117681532 GGCCCCTCTGGACAAGCTGCAGG + Intronic
1089842005 11:121426652-121426674 GGCGATTCAGGGCCAGCTGCAGG + Intergenic
1090860290 11:130647090-130647112 GGCCTGTCTGGGGCAGGAGCAGG + Intergenic
1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG + Intronic
1091274397 11:134340596-134340618 GGCCCCTCTGGGCCACCGTCCGG - Intronic
1092143864 12:6201397-6201419 GGCTCTCCTGGGCGGGCAGCTGG - Intronic
1092883634 12:12907138-12907160 TTCCCTTCTGAGCCAGCGGCTGG - Intronic
1096234678 12:49918069-49918091 GCCTCTTCTGGCCCAGCAGTGGG + Intergenic
1097194141 12:57234649-57234671 TGCCCTTCAGAGCCAGTAGCAGG + Exonic
1099668474 12:85660277-85660299 GTCCCTTCTGGGGCACCACCTGG + Intergenic
1101734770 12:107454683-107454705 GGTCCTTCCTGGGCAGCAGCAGG + Intronic
1102099471 12:110267291-110267313 GGCCCTTTTTGGCCAGCACTTGG + Intergenic
1103403062 12:120656179-120656201 CGCAGTTCTGGGCCAGCATCAGG - Intronic
1103568309 12:121828119-121828141 GGCCCTCCTGGCACAGAAGCAGG - Intronic
1104935933 12:132364478-132364500 TGGGCTTCTGGGCCAGCAGGAGG - Intergenic
1104947718 12:132424033-132424055 GGCCCTTGTGGGTCTGCAGCTGG - Intergenic
1105945373 13:25185279-25185301 GGCCCCTCTGGTCCCTCAGCTGG - Intergenic
1106249406 13:27972234-27972256 GGCTTCTCTGGCCCAGCAGCAGG - Intergenic
1107828192 13:44350039-44350061 GGCCCTTCACCTCCAGCAGCAGG + Intergenic
1109793490 13:67279508-67279530 GCCACTTCTGTGCCAGCAGGGGG - Intergenic
1111123330 13:83881186-83881208 GGCTTTTCTGGGGCTGCAGCTGG - Exonic
1113786607 13:113005254-113005276 TGCCTTTCTGTGCCTGCAGCTGG - Intronic
1113885391 13:113656183-113656205 GGACCTGCAGGGCCAGCACCAGG - Intronic
1115362293 14:32517549-32517571 GGACCCTCTGAGCCAGAAGCAGG - Intronic
1115645347 14:35365478-35365500 GGCCCCTCAGGGCCAGGACCAGG - Intergenic
1117842135 14:59870700-59870722 GTCCCTCCGGGGACAGCAGCAGG - Exonic
1118730633 14:68663508-68663530 AGCCCTCCAGGGCTAGCAGCGGG - Intronic
1119540169 14:75432655-75432677 CTCCCCTCCGGGCCAGCAGCTGG - Intronic
1119830463 14:77697471-77697493 GGCTGTTCTGGGCCCACAGCTGG - Intronic
1120735419 14:88046917-88046939 GGCTCTTCTGGGATAGCTGCGGG - Intergenic
1121335763 14:93076750-93076772 GGCTGTTCTGGGACAGTAGCAGG - Intronic
1121493625 14:94377555-94377577 GGCCTTCCTGAGCCATCAGCAGG + Exonic
1121686662 14:95840497-95840519 GGCCTTTCTGGGGCAGCACTAGG - Intergenic
1122798562 14:104218461-104218483 GGCCTGTCTGGGCCAGTGGCAGG + Intergenic
1122880055 14:104686728-104686750 AGCCCTTCTGGGCCTGCAAGTGG + Intergenic
1122983124 14:105200450-105200472 GGCCCTCCAAGGCCACCAGCAGG + Intergenic
1123014117 14:105365448-105365470 TGCTCTGCTGGGCCCGCAGCGGG - Intronic
1123213652 14:106785357-106785379 GGCCCTGCAGGCCCAGCAGGAGG - Intergenic
1202904041 14_GL000194v1_random:58453-58475 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1124232131 15:27954851-27954873 TGCCCTTCAGGGCCAGGAGCGGG + Intronic
1124611846 15:31214857-31214879 GCCCCTCCTGGGTCAGAAGCTGG + Intergenic
1124696404 15:31868025-31868047 AGCTCTTGTGGGCCAGCAGGGGG - Intronic
1124925015 15:34062639-34062661 AGCTCTTCTTGGCCAGCATCTGG - Exonic
1125725442 15:41866106-41866128 GGCCCTCAGGGGCCAGGAGCTGG - Exonic
1126315498 15:47365077-47365099 GGCCCTTCCAGGCCAGCTGAAGG - Intronic
1127637888 15:60888811-60888833 GCCCTTCCTGAGCCAGCAGCAGG + Intronic
1127964803 15:63915606-63915628 GGCACTGCTGGGCCAGGAGGAGG - Intronic
1128886197 15:71290214-71290236 GGACCTGCTGTGCCAGCACCAGG - Intronic
1129312529 15:74722674-74722696 GGCCATTCTGGGCCAGGCGCCGG + Exonic
1129316814 15:74750146-74750168 GGGCATTCTGGGCCAGGCGCCGG - Exonic
1129799340 15:78401851-78401873 GGCCCTTCTGGCTCACCTGCTGG - Intergenic
1130579054 15:85118414-85118436 GGCCTCACTGGGACAGCAGCAGG - Intronic
1130738267 15:86572164-86572186 GGCACTTCCGGGCCCGCAGGGGG + Intronic
1131449559 15:92528051-92528073 GCCCCTCCTGGGCCAGCTCCTGG + Intergenic
1131649964 15:94387807-94387829 GGCCCTCCCTGGCTAGCAGCTGG - Intronic
1132111575 15:99105592-99105614 GGCGCTGCTGGGCCGGCTGCAGG + Exonic
1132684073 16:1154933-1154955 GGCCCTTCTGAGCCGGCAGCTGG + Intronic
1132876980 16:2144331-2144353 GGCCCTTGTGTGCCAGGAGAGGG - Intronic
1132899241 16:2244352-2244374 GGCTGTTCTGGGCCAGCGCCAGG - Intronic
1132969161 16:2676884-2676906 GGGCCTTGTGGGCCAGAAGAAGG - Intergenic
1134684643 16:16150171-16150193 GGCCCTTCTGGGCCAGCAGCTGG + Exonic
1135980356 16:27142333-27142355 TGCCCCTCTGGGCCGGGAGCAGG + Intergenic
1136025324 16:27464815-27464837 GGCCCTCCTGGAGCAGCATCAGG - Exonic
1136513153 16:30751459-30751481 GGCCACCCTGGGACAGCAGCGGG - Intronic
1137442884 16:48511147-48511169 GGCTCCTCTGGCCCAGCATCAGG - Intergenic
1138201246 16:55090340-55090362 GGCCCTTCTGGGCTACCAGGAGG - Intergenic
1138448854 16:57081143-57081165 GGCCCATCTGCGGCAGCACCTGG - Exonic
1138607290 16:58097315-58097337 GGCCCTTCTGAGCCAAGAACAGG + Intergenic
1139551477 16:67675394-67675416 TGCCCTTCAGGTACAGCAGCGGG + Exonic
1140224128 16:73065193-73065215 AGCCCTCCTGGGCCAGCGCCGGG + Intergenic
1141705327 16:85661554-85661576 GACCATCCTGGGCCAGCAGCGGG + Exonic
1141908573 16:87043227-87043249 GGCCCGTCTGTGACAGCACCAGG - Intergenic
1142356065 16:89602675-89602697 GGCCCTGCTGTGCCAGGGGCCGG - Intergenic
1145750815 17:27353931-27353953 GGCCCTTCTCGGCCGGCAGGGGG + Intergenic
1146279159 17:31533853-31533875 GGCCCCTCTGGCACTGCAGCAGG - Exonic
1146401554 17:32504033-32504055 GTCCTTTCTGGGTCTGCAGCTGG + Intronic
1146492199 17:33291470-33291492 GGACCGCCTGGGCCACCAGCTGG - Exonic
1146650157 17:34601611-34601633 GGCCCTGATGGCCCAGCTGCTGG - Intronic
1147612466 17:41810096-41810118 GGGCATTCTGGGAGAGCAGCAGG + Intronic
1147845285 17:43400245-43400267 GGACGGTCTGGGCCTGCAGCAGG + Exonic
1148239966 17:45993822-45993844 GCCCCTGCTGGGCCAGCTGTGGG + Intronic
1148360073 17:47004439-47004461 TGCCCTCAGGGGCCAGCAGCAGG + Intronic
1150410809 17:64939210-64939232 GGCATTGCTGAGCCAGCAGCAGG + Intergenic
1150983431 17:70169271-70169293 GGCCCAGCTGGGACAGCAGCAGG - Intronic
1151426037 17:74031766-74031788 TCCCCTCCTGGGCCATCAGCAGG + Intergenic
1151621272 17:75246547-75246569 GGATCTTGTGGGCCAGCAGTCGG + Exonic
1151840906 17:76616712-76616734 CGCCCTTGTGGGCCTGGAGCCGG - Intergenic
1151973522 17:77471304-77471326 GGCCCTTCAGAGACAGCAGGGGG - Intronic
1152146093 17:78569787-78569809 TGCCCTTCTGGTCCTGCAGACGG + Intronic
1152263948 17:79282615-79282637 ACCCCTTCTGGGTCAGCGGCCGG - Intronic
1152307780 17:79531240-79531262 GACCCTCCTGGGCCGGCAGCAGG - Intergenic
1152397126 17:80040241-80040263 GTCACCTCTGGGCCAGCAGTGGG + Exonic
1152431252 17:80249269-80249291 GGCCTTTGTGGGCCTGCAGGTGG + Exonic
1152597571 17:81245501-81245523 TGCCCTCCTCGGCCAGCAGCAGG - Exonic
1152739305 17:82012050-82012072 GGCCCTTCCGAGCCCTCAGCTGG + Intronic
1152754231 17:82080438-82080460 GGCTCTGCTGGGCCTGCAGCTGG + Exonic
1152829849 17:82490565-82490587 GGCCCTGCTGGGGCAGCAGGTGG - Intergenic
1160743256 19:697498-697520 GGCCCTTCTGGGCTAACGTCAGG - Intergenic
1160793287 19:932777-932799 GGCCCCACTGGCCCAGGAGCAGG - Intronic
1160905898 19:1451634-1451656 AGCCCCTCTGGGGCAGCATCTGG + Exonic
1161118622 19:2512973-2512995 GGCTCTCCCGGGCCAACAGCAGG + Exonic
1161126728 19:2562013-2562035 GGCTCTTCTGGGAGACCAGCGGG + Intronic
1161156319 19:2733473-2733495 GGACCTTCTGGAGCTGCAGCCGG + Exonic
1161216921 19:3099257-3099279 GCCCCTTCTGGGTCCCCAGCAGG + Intronic
1161321030 19:3641647-3641669 GGCTCCTCTGGGCCCGCAGCAGG + Intronic
1161574731 19:5049097-5049119 GGCCCCTCTGACCTAGCAGCAGG - Intronic
1161621410 19:5299214-5299236 GGGCCTTGTGGGCCACCAGGAGG - Intronic
1161623186 19:5309995-5310017 GGCCCTTGTGGGGCACCAGGAGG - Intronic
1161720389 19:5899016-5899038 GGGGCTGCTGGGCCAGGAGCAGG - Intronic
1162349514 19:10140158-10140180 CTCCCTTCTGGGGCAGCCGCTGG + Exonic
1162380450 19:10328803-10328825 GGACCTGCTGGGCAAGCCGCTGG - Exonic
1162733840 19:12734764-12734786 GGCCCTCCAGCGCCCGCAGCGGG + Exonic
1163123836 19:15233460-15233482 GGGCCTGTTGGGCCAGCAGGAGG - Intergenic
1163288447 19:16363830-16363852 GGCAGTTCTGGGCCAGCATAAGG + Intronic
1163313560 19:16528079-16528101 GGCTCCTTGGGGCCAGCAGCAGG - Exonic
1163972071 19:20808060-20808082 GGACCCTCTGAGCCAGCTGCAGG - Intronic
1164918583 19:32071764-32071786 GCTCCTTCTGGGCCAGGAGCTGG + Intergenic
1165435245 19:35791653-35791675 TTCACTTCTGGGCCAGCACCCGG - Intergenic
1165449028 19:35871723-35871745 GACCCATCTGGGACAGCAGTTGG + Exonic
1166069787 19:40380422-40380444 GGCCCTGCCGGGGCAGCAGCTGG - Exonic
1166782412 19:45349476-45349498 GGCCCTGCTGTGCCAGAACCAGG + Exonic
1166851606 19:45764070-45764092 AGGCCTTCTCGGCCAGCAGCTGG - Exonic
1167068224 19:47203152-47203174 AGCCCTTCTGGGCCAGGATGGGG - Intronic
1168407613 19:56119136-56119158 GGCCCTTCTGTGCAAGCACAAGG - Intronic
925017786 2:544820-544842 GCCCCTCCTGGCCCTGCAGCTGG + Intergenic
927478249 2:23430548-23430570 GTCCCTTTTGGGCCAGCTGGAGG - Intronic
927927511 2:27024203-27024225 GGCCCTGCCGCGCCAGCAGAGGG - Exonic
928723729 2:34148060-34148082 GGCACTTCTGGGCCTTCAGAGGG + Intergenic
929381419 2:41358811-41358833 GGACCCTCTGAGCCAGGAGCGGG - Intergenic
930720548 2:54633586-54633608 GGCCAGTCTGGGCCAGCCACTGG + Intronic
933764088 2:85695396-85695418 GGCCCTCCTGGGCCAGGCACGGG - Exonic
933806214 2:85999690-85999712 AGCCCATCGTGGCCAGCAGCAGG + Intergenic
934028338 2:88018929-88018951 GTCCCTTTGGGGCCTGCAGCTGG + Intergenic
934579756 2:95428526-95428548 GGCTCTTGGGGGCCAGCAGGTGG - Intergenic
934599691 2:95648199-95648221 GGCTCTTGGGGGCCAGCAGGTGG + Intergenic
934708814 2:96502436-96502458 GACCTGCCTGGGCCAGCAGCAGG - Intronic
935175151 2:100642705-100642727 GACCCTCCTGGGCCAGCTTCAGG + Intergenic
935580875 2:104755063-104755085 AGCCCTTCTAGGCAGGCAGCAGG - Intergenic
935814882 2:106838287-106838309 GGAGCTGCTGGGCCAGCACCCGG + Intronic
936937599 2:117853255-117853277 AGGCATTCTGGGGCAGCAGCAGG + Intergenic
938313982 2:130314071-130314093 GCTGCTTCTGGACCAGCAGCAGG + Intergenic
940182660 2:150953540-150953562 GGACCTTCTGAGCCAGGAGAAGG - Intergenic
942465981 2:176208090-176208112 GGCACTTTTGGTCTAGCAGCTGG - Intergenic
944473861 2:200084434-200084456 GGACCTTCTGAGAGAGCAGCAGG - Intergenic
944483808 2:200182471-200182493 GGCCCTTTTGGGCCTGAAGGTGG - Intergenic
944510139 2:200456446-200456468 AGACCTTCTGGGCTAGCAACAGG - Intronic
946239215 2:218343684-218343706 GTCGCTTCTGGGCCAGGAACTGG - Intronic
946371125 2:219281944-219281966 GGCCCATCTCGGGCAGAAGCTGG + Exonic
948264485 2:236627041-236627063 GGCACTTATGTGGCAGCAGCAGG - Intergenic
948430559 2:237915843-237915865 GGCATTTCAGAGCCAGCAGCTGG + Intergenic
948897260 2:240933268-240933290 GGCTCTTCGGGGCCAGCTGGAGG + Intronic
948909547 2:240996235-240996257 GGCCTCTCTGGGCCATGAGCAGG + Intergenic
1170299096 20:14861842-14861864 GGTCCTGCTTGGCCAGCAGCAGG - Intronic
1171104600 20:22420729-22420751 GGCCCACCAGGCCCAGCAGCTGG + Intergenic
1171399004 20:24859477-24859499 GGCCCTGGTGGGCTAGCATCGGG + Intergenic
1171786666 20:29471935-29471957 GGACCCTCTGGGCCAGGTGCGGG + Intergenic
1171977622 20:31605549-31605571 TGCCCTGCTGGACGAGCAGCAGG + Exonic
1172127652 20:32634466-32634488 AGCCCTGCTGGGCCCGGAGCTGG - Intergenic
1172183850 20:33019535-33019557 GGCCCTGCTGAGGCAGCGGCTGG - Intronic
1172446624 20:34996784-34996806 GGGCCTTCTGAGCCTGCACCTGG + Intronic
1173226231 20:41163859-41163881 GGCCCTCCTGGGGAAGAAGCTGG - Intronic
1174056244 20:47800365-47800387 GGCTCTTCTGAGACAGCACCAGG - Intergenic
1174115301 20:48222848-48222870 GGCCCTTGTGGGCCATTAGAAGG + Intergenic
1174179911 20:48668301-48668323 GGCCCGTGGGGGCCAGGAGCCGG + Intronic
1175265938 20:57703554-57703576 GGGCCTCTTGGGCCAGCAACGGG + Intronic
1175754334 20:61519936-61519958 GGCCCATGTGGCCCAGCAGTTGG - Intronic
1176546665 21:8205318-8205340 TGCGCTTCTGGGCCCGCGGCGGG + Intergenic
1176554560 21:8249508-8249530 TGCGCTTCTGGGCCCGCGGCGGG + Intergenic
1176565616 21:8388365-8388387 TGCGCTTCTGGGCCCGCGGCGGG + Intergenic
1176573481 21:8432533-8432555 TGCGCTTCTGGGCCCGCGGCGGG + Intergenic
1176623413 21:9073220-9073242 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1176644702 21:9339507-9339529 GGACCTTCTGAGCCAGGTGCGGG + Intergenic
1177616715 21:23532019-23532041 GTCCCTTGTAGGCCAGCAGATGG - Intergenic
1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG + Intronic
1179967096 21:44813612-44813634 GGCCATTCTGGGGCTGCAGGTGG - Intronic
1180179452 21:46111524-46111546 GGCCATCCAGGCCCAGCAGCAGG + Exonic
1180693594 22:17738115-17738137 CCACCTTCTTGGCCAGCAGCAGG + Exonic
1180951820 22:19723882-19723904 GGCTCGGCGGGGCCAGCAGCAGG - Exonic
1181003425 22:19998502-19998524 GACCCTTCTGGGTGGGCAGCTGG - Intronic
1181041040 22:20192746-20192768 GGCCCCTCAGGACCATCAGCGGG - Intergenic
1181107490 22:20583687-20583709 GGCCCATCTGGGCCAGCTGATGG - Intronic
1181620850 22:24090207-24090229 GGCCCATCTGGGCTGGCATCTGG - Intronic
1182881219 22:33735164-33735186 GGCCCTTCTCAGCCAGGAGAAGG + Intronic
1183403218 22:37616937-37616959 GGATCTTGTGGGCCAGCAGCCGG - Exonic
1183461562 22:37953979-37954001 GGCCCTCCTGTGCCTCCAGCCGG - Intronic
1183591857 22:38783637-38783659 TGTCCTGCTGGCCCAGCAGCTGG + Intronic
1184237020 22:43187789-43187811 GGCGCTTCTGTGCCTGCACCGGG + Intergenic
1184279210 22:43427464-43427486 GGCCCAGCTGGGCAGGCAGCAGG + Intronic
1184472342 22:44702833-44702855 GGCGCTTCTGGGCCAGCCCCGGG - Intronic
1184943430 22:47784611-47784633 GGCCCTCCTGGGATAGCAGCAGG + Intergenic
1185020517 22:48372035-48372057 GGAAGTTCTGGGCCTGCAGCAGG + Intergenic
1185344623 22:50305879-50305901 GGCCCTGCTGAGCCTGCAGTGGG - Intronic
1185345401 22:50308433-50308455 GGTCCTTCAGGGCCAGGAGGTGG + Intergenic
1203251530 22_KI270733v1_random:121584-121606 TGCGCTTCTGGGCCCGCGGCGGG + Intergenic
950155251 3:10716949-10716971 GGCCTCTCTAGGCCAACAGCCGG + Intergenic
952776756 3:37053850-37053872 AGCACTTCTGGCCCAGCAGTAGG - Exonic
953464369 3:43105933-43105955 GGGCCTCCTGGGCCAGAAGCTGG - Exonic
953726839 3:45406978-45407000 GCACCTTCTGGTCCAGAAGCCGG + Intronic
954138314 3:48592452-48592474 GGCCCTTCTAGGGCAGCTGGGGG + Exonic
954219753 3:49145761-49145783 GGACCTTTTGGGCCAGGAGAGGG - Intergenic
954370465 3:50167322-50167344 GGACCTTCTGTCCCAGCAGATGG - Intronic
954405584 3:50343357-50343379 AGCCACTCTGGGCCACCAGCAGG + Exonic
954450313 3:50567947-50567969 GGCCCTTCCGGGCCAGAACTCGG + Intronic
954945592 3:54421494-54421516 GGCCCTCCTGGCTCAGGAGCAGG - Intronic
956233785 3:67043972-67043994 GGAGCTTCTGGGCCAGGAGAAGG + Intergenic
957674636 3:83350691-83350713 GGCCCTTCCAAGACAGCAGCCGG - Intergenic
960583932 3:119303542-119303564 AGGCATTCTGGGCCAGCATCAGG - Intronic
960964280 3:123093941-123093963 GGCCGCTCAGGGACAGCAGCAGG - Intronic
961500148 3:127326636-127326658 GGTGCTTCTGGAGCAGCAGCTGG - Intergenic
962177883 3:133174033-133174055 GGACCCTCTGAGCCAGGAGCGGG - Intronic
963258520 3:143170167-143170189 GGACCTCGTGGGTCAGCAGCAGG - Intergenic
964479492 3:157127651-157127673 GCCCCTTCCCCGCCAGCAGCAGG + Intergenic
965367677 3:167820427-167820449 GGCACTTCTGAGCCTGCAGTGGG - Intronic
965522045 3:169678030-169678052 GGGGCTTCTGGGCCAGTAGCAGG - Intergenic
965672064 3:171157561-171157583 GGCCCTACGGAGGCAGCAGCTGG - Exonic
967963043 3:194940533-194940555 AGCCCCTCTGAGCCAGCAGTGGG - Intergenic
968288604 3:197522344-197522366 GCCCCCTCTGGCCCAGGAGCTGG - Intronic
968473724 4:793288-793310 GGCCCTGCTGGGGCAGGAGCTGG + Intronic
968643377 4:1726283-1726305 GGTCCTTCTGTGCCTGCAGGTGG + Intronic
968709749 4:2105170-2105192 GGCAATTGGGGGCCAGCAGCAGG - Intronic
969040307 4:4290430-4290452 TGCCCTTCTGGGCCACCTTCGGG - Intronic
969202703 4:5618409-5618431 GACCCTGTAGGGCCAGCAGCTGG + Intronic
978822375 4:112980296-112980318 GGCACTTCTGAGCCTGCAGGTGG + Intronic
980878837 4:138688985-138689007 GGCTCGTCCGCGCCAGCAGCTGG - Intergenic
981568926 4:146131423-146131445 GGCCCTGCTGGGCCCGCCACTGG + Intergenic
983125954 4:163950453-163950475 GGCACTTCTGAGCCTGCAGCAGG + Intronic
983484559 4:168318434-168318456 CGGCCTTCCGGGCCAGCAGGGGG + Intronic
983660697 4:170128043-170128065 GGCCCTCATGGTGCAGCAGCAGG + Intergenic
983699372 4:170572695-170572717 GGCTCTTCTGGGTCTCCAGCTGG + Intergenic
985520857 5:373459-373481 GGCACAGCTGGGCCAGCAGGAGG - Intronic
985915963 5:2919511-2919533 GCCCCTTTAGTGCCAGCAGCTGG - Intergenic
987439077 5:17933169-17933191 GGCCCCACTGGGCCACCACCGGG + Intergenic
989659649 5:43786618-43786640 GGAGCTTCTGGGCCAGAAGAAGG - Intergenic
991079693 5:62584901-62584923 GGCACATCTGGGCCAGCAGCAGG - Intronic
991083594 5:62627147-62627169 GGTCCTTCAGGGCCAGCTGTGGG - Exonic
994647948 5:102492741-102492763 GGACCCTCTGAGCCAGGAGCGGG - Intronic
996142491 5:119929238-119929260 GGGACTGCTGGGCCAGAAGCTGG + Intergenic
998413390 5:141928159-141928181 GGCCGTGCTGGCCCTGCAGCTGG + Exonic
998461697 5:142314673-142314695 GGCCCTTGAGGTCCAGCGGCTGG + Exonic
998626487 5:143852418-143852440 GGACCTTCTGAGCCAGGTGCGGG - Intergenic
1002133016 5:177092819-177092841 TGCCCCTCTGGGCCAGCAGTGGG + Intronic
1002522853 5:179800984-179801006 AGGCCTTTTGGGGCAGCAGCAGG - Intronic
1006436006 6:34026557-34026579 GGCCCCTCTGGGCAGGAAGCAGG + Intronic
1006516052 6:34546356-34546378 TGCCCTACTGGGACAGCAGGAGG + Intronic
1006555110 6:34859239-34859261 GGCCCTTCCCTGCCAGCTGCTGG - Exonic
1006568726 6:34982545-34982567 GGCCATTCTGTGCCACCAGCAGG - Intronic
1006595301 6:35188803-35188825 GGCCCTTCTGCCCAAGCACCTGG - Intergenic
1007570978 6:42890695-42890717 GGCCCTGCTGGACCAGCTGCAGG + Exonic
1007705813 6:43790523-43790545 GGCCTTTCAGGGCCGGGAGCAGG - Intergenic
1007790433 6:44305406-44305428 GGCCCTCCAGGGGCAGCAGTGGG - Intronic
1007892330 6:45306973-45306995 GGACCTTCTGAGCCAGGTGCGGG - Intronic
1008414534 6:51224683-51224705 GGACCTTCAGGGCCAGTCGCAGG - Intergenic
1008825159 6:55684997-55685019 GGACCTTCTGAGCCAGGTGCGGG - Intergenic
1009628654 6:66166828-66166850 GGACCTTCTGAGCCAGGCGCAGG - Intergenic
1009983019 6:70748069-70748091 GGCCCTTCTTTTCCAGCAGCTGG + Intronic
1018064990 6:160118594-160118616 GGCCCTTCTTGGCCTGAAGGTGG + Intergenic
1018941210 6:168309793-168309815 GCCCCTCCTGGGCCAGCGGGTGG + Intronic
1019145051 6:169970985-169971007 ATCCCTGCTTGGCCAGCAGCTGG + Intergenic
1019195743 6:170281701-170281723 GGTCCTGCTGAGCCAGCAGGCGG + Intergenic
1019357394 7:587754-587776 GGGCCTCCTGCCCCAGCAGCTGG - Intronic
1019626647 7:2019247-2019269 GGCCCTGCTGGGACAGAGGCTGG + Intronic
1019717382 7:2545807-2545829 GGCCCTTGTCTGTCAGCAGCTGG - Intronic
1021175887 7:17449471-17449493 GGTGCCTTTGGGCCAGCAGCAGG - Intergenic
1021581105 7:22154341-22154363 CTCCCTTCTGGGCCCGCAGCTGG - Intronic
1023247120 7:38216929-38216951 GACCCGTCTGAGCCAGGAGCAGG - Intronic
1025236754 7:57239790-57239812 GGCTCTTCTGAGACAGCACCAGG + Intergenic
1026670202 7:72383596-72383618 GGACCATCTGCGCCAGCTGCTGG - Intronic
1027780011 7:82508350-82508372 GGCACTTCTGAGCCTGCAGGGGG + Intergenic
1027915261 7:84309556-84309578 GACCCTTCTGGGCTAGCAATGGG + Intronic
1029270144 7:99372709-99372731 GCCCCTTCTGAGCGAGCTGCAGG - Intronic
1029440024 7:100582394-100582416 GGCCCTCCAGGGACACCAGCTGG + Exonic
1029524809 7:101088104-101088126 GGCCCTGCTGGCCCAGAAGCAGG + Exonic
1030365189 7:108637612-108637634 GGCCCTGCTGGGCCCACAGCTGG - Intergenic
1031477304 7:122238860-122238882 GGACCTTCTGAGCCAGGTGCAGG - Intergenic
1032011853 7:128352178-128352200 GGCGCGGCCGGGCCAGCAGCAGG + Exonic
1034560285 7:151875953-151875975 GGCGTTTCTGGGCCTGGAGCGGG - Intronic
1035358901 7:158296811-158296833 GGCCTTTCTGAGGCAGCAGATGG + Intronic
1035468712 7:159096347-159096369 GGCGCTTCTGGGCATGGAGCTGG - Intronic
1036177829 8:6556029-6556051 GGCACTCCTAGGCCAGCATCAGG - Intronic
1040386422 8:46917818-46917840 GGCGCTGCGGGGCCAGCAGGGGG + Intergenic
1040386498 8:46918110-46918132 GGGCCCCCTGGGCCGGCAGCTGG - Intergenic
1040403393 8:47075853-47075875 GGACCCTCTGAGCCAGGAGCGGG - Intergenic
1041314875 8:56550653-56550675 GGACCCTCTGGGCCAGGCGCGGG - Intergenic
1042476522 8:69254557-69254579 GGCCCCTCTGAGCCAGGTGCAGG - Intergenic
1042926956 8:73976411-73976433 GGGCCTTCGGGGCCGGTAGCCGG + Exonic
1043542807 8:81281410-81281432 GGCCCGGCAGTGCCAGCAGCAGG - Intronic
1044007890 8:86960338-86960360 GGACCCTCTGAGCCAGGAGCGGG - Intronic
1044418205 8:91960376-91960398 GACCCTGCAGGCCCAGCAGCAGG - Exonic
1045373887 8:101552218-101552240 GGCCATACTGAGCCAGTAGCTGG - Intronic
1047349070 8:124056030-124056052 GGTCCTTATGAGGCAGCAGCAGG - Intronic
1048858442 8:138703979-138704001 GGACCTTCTGAGCCAGGTGCGGG - Intronic
1048877716 8:138850216-138850238 GGGCCTTCTGGGGAGGCAGCTGG - Intronic
1049214382 8:141401081-141401103 GCCTCTTCTGGGCCAGCAGCCGG + Intronic
1049214576 8:141401879-141401901 GGCCCTGCTGGGGCCACAGCGGG - Intronic
1049608494 8:143541145-143541167 GGCCCTGCTGGGGCTGCAGAGGG - Intronic
1049994645 9:1023486-1023508 GGTCCCTCTGGGCAAACAGCTGG - Intergenic
1050030224 9:1378240-1378262 GAGCCTTCTGGGCCTGCAGAGGG + Intergenic
1050898063 9:10909398-10909420 GGAGCTTCTGGGCCAGGAGAAGG - Intergenic
1051603529 9:18897455-18897477 GGAGCATCTGGGCCAGCAACAGG + Intronic
1052576543 9:30299301-30299323 GGCGCTTGTGGGCCAGCGCCCGG + Intergenic
1053895184 9:42735973-42735995 GGAGGTTCTGGGCCTGCAGCGGG - Intergenic
1056453939 9:86742552-86742574 AGCACTTCTGGCCCAGTAGCAGG - Intergenic
1056810082 9:89757364-89757386 GGTCCTGCTGGGACTGCAGCTGG + Intergenic
1056986095 9:91364598-91364620 GGCCCTCCTTGGCCAGAAGCTGG - Intergenic
1057481676 9:95449479-95449501 GGACCTTCAGGTCCCGCAGCTGG + Intronic
1057759909 9:97863606-97863628 GACCCGTCTGGGCCTGCAGCTGG + Intergenic
1058367083 9:104221101-104221123 GGACCCTCTGAGCCAGGAGCAGG + Intergenic
1060208136 9:121694543-121694565 GGACCTTCTGGAGAAGCAGCAGG + Intronic
1060301328 9:122376119-122376141 GGCCTTTCTGGGCCTGTGGCTGG + Intronic
1060747716 9:126148716-126148738 GCCACATCTGGGCCACCAGCAGG - Intergenic
1060827047 9:126693474-126693496 GGCCCTCCAGGGGCAGCAACGGG - Intronic
1060968400 9:127724315-127724337 GGCCCTCCGGGACGAGCAGCAGG + Exonic
1061053345 9:128208808-128208830 GGGCTTTCTGGGCCATCAGAAGG + Intronic
1061199207 9:129126862-129126884 GGCCCAGCTGAGCTAGCAGCTGG + Intronic
1061288722 9:129638983-129639005 GGCCCTTGAGGGCCAGCACAGGG + Intronic
1061496455 9:130977637-130977659 GGCGCTTCGGAGCCAGCAACAGG + Intergenic
1061887315 9:133598278-133598300 GGCCCTTCTGAGCGAGCATGGGG + Intergenic
1061938531 9:133871882-133871904 GCCCCTTCTGAGCCCCCAGCAGG + Intronic
1062405792 9:136395611-136395633 CCCGGTTCTGGGCCAGCAGCAGG + Exonic
1062538348 9:137030618-137030640 GGCCCTTACCGGCAAGCAGCGGG - Exonic
1203746597 Un_GL000218v1:43648-43670 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1203467932 Un_GL000220v1:104735-104757 TGCGCTTCTGGGCCCGCGGCGGG + Intergenic
1203475753 Un_GL000220v1:148707-148729 TGCGCTTCTGGGCCCGCGGCGGG + Intergenic
1203710818 Un_KI270742v1:95485-95507 GGACCTTCTGAGCCAGGAGCGGG - Intergenic
1203563512 Un_KI270744v1:75832-75854 GTTGCTTCTGGGCCAGCAGCAGG - Intergenic
1190597080 X:52061196-52061218 AGCCCTTCTCCCCCAGCAGCAGG - Intergenic
1190611744 X:52192877-52192899 AGCCCTTCTCCCCCAGCAGCAGG + Intergenic
1191092188 X:56635367-56635389 GGACCCTCTGGGCCAGGTGCAGG + Intergenic
1192588464 X:72339732-72339754 GGCCATGATGGGGCAGCAGCTGG - Intronic
1195551013 X:106171061-106171083 GACCCTGCTGGACAAGCAGCTGG + Exonic
1195554284 X:106204088-106204110 GGCCCTGCTGGACAAGCAGTTGG + Exonic
1196108081 X:111917569-111917591 GTCCCTACTGGGAAAGCAGCAGG + Intronic
1198615661 X:138456185-138456207 GGACCCTCTGAGCCAGGAGCGGG - Intergenic
1199975599 X:152893396-152893418 GCTGCTTCTGGGGCAGCAGCAGG + Intergenic
1200104839 X:153706406-153706428 TGCCCTTCCAAGCCAGCAGCAGG + Intronic
1200835183 Y:7725685-7725707 GGCACCTCTGGGCCAGCACGAGG + Intergenic
1201159924 Y:11158662-11158684 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1201476861 Y:14391693-14391715 GGACCCTCTGTGCCAGCTGCAGG + Intergenic