ID: 1134687680

View in Genome Browser
Species Human (GRCh38)
Location 16:16169988-16170010
Sequence GCTTCTGGTGGGAGGCACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 394}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134687680_1134687685 -6 Left 1134687680 16:16169988-16170010 CCGCTGTGCCTCCCACCAGAAGC 0: 1
1: 0
2: 3
3: 45
4: 394
Right 1134687685 16:16170005-16170027 AGAAGCACCATTTCCCCGACAGG 0: 1
1: 0
2: 3
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134687680 Original CRISPR GCTTCTGGTGGGAGGCACAG CGG (reversed) Intronic
900153946 1:1196581-1196603 GCTTCTGCAGGGAGGCAGGGAGG - Exonic
900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG + Intronic
900701909 1:4053772-4053794 GCTTCTGGTGGCAGGCACCCGGG - Intergenic
901005923 1:6171455-6171477 GCTTCTGGTGGGTGGCCCTGAGG + Intronic
901020710 1:6253951-6253973 GCTGCTGGTGGGCGGCAGCGTGG - Exonic
901174132 1:7286155-7286177 CCTGCTGGTGGGGGGCAGAGAGG + Intronic
901203226 1:7478414-7478436 GGTCCTGGTGGCAGTCACAGGGG - Intronic
901444845 1:9301841-9301863 GCACCTGGTGGAAGGCACATTGG + Intronic
901916904 1:12507066-12507088 GCTTCTGGTGGGAGGGGCCGGGG - Exonic
902885621 1:19402733-19402755 GCTTCTGATGTGAGGAACATGGG - Intronic
902976244 1:20090593-20090615 GCTTCCGGTCACAGGCACAGAGG - Exonic
903189482 1:21648861-21648883 GCCTGGGGTGGGAGGCACACAGG - Intronic
903459081 1:23508427-23508449 ACTTCTGGAGAGAGGCTCAGGGG - Exonic
903708193 1:25302375-25302397 GGCTCGGGTGGGAGGCACTGGGG + Intronic
903718916 1:25390038-25390060 GGCTCGGGTGGGAGGCACTGGGG - Intronic
904009199 1:27380357-27380379 GCGCCTGGTGGGAGGAACAGTGG + Intronic
904092532 1:27955469-27955491 ACTCCAGGTGGCAGGCACAGAGG + Intronic
905808516 1:40894411-40894433 GCCTGTGGTGGGAGGGACTGAGG + Intergenic
905873572 1:41418440-41418462 GCTTTGGGTGGGAGGGAAAGTGG + Intergenic
905901233 1:41583178-41583200 GCTTCTCAGGAGAGGCACAGGGG + Exonic
905920657 1:41716570-41716592 GCTTCTTGTAGGAGGAGCAGTGG + Intronic
906471420 1:46133705-46133727 TCTTTGGGTGGGAAGCACAGAGG - Intronic
906708610 1:47912961-47912983 GCCTCTGGTGGAAGGCACAGGGG - Intronic
907490751 1:54807394-54807416 GCTGAGGGTGGGAGCCACAGGGG + Intronic
907526872 1:55058840-55058862 GCTGCTGGAGAGAGCCACAGCGG + Intronic
908035929 1:60052970-60052992 GTTTCTAGTGGGAGGCTCAGCGG - Intronic
908106848 1:60853693-60853715 GTTCCTGGTGGCTGGCACAGTGG - Intergenic
908326496 1:63028729-63028751 GTCACTGGTGGGAGGCACAGAGG - Intergenic
911864136 1:102994463-102994485 GCTTCCAGTGGAAGGCAAAGAGG - Intronic
911986535 1:104632670-104632692 GCTTCCAGTGGAAGGCAAAGGGG + Intergenic
912442862 1:109712360-109712382 TCCTCTGGTGGGTGGGACAGGGG + Intronic
912499976 1:110115175-110115197 GCTTTTGAAGGGAGGAACAGGGG - Intergenic
913666915 1:121057267-121057289 GCTCCTAGTGGGAGGAGCAGGGG + Intergenic
914657214 1:149752894-149752916 GCTCCTAGTGGGAGGAGCAGGGG + Intergenic
914697560 1:150099358-150099380 GGGTGTGGTGGCAGGCACAGTGG + Intronic
914943637 1:152044713-152044735 GCTTCAGGTGGGTGGCACTCAGG - Intronic
915154258 1:153861376-153861398 GCCCGGGGTGGGAGGCACAGTGG - Intronic
919973049 1:202593081-202593103 GCTTTAGGTGGGAGGGGCAGAGG + Exonic
920209668 1:204319121-204319143 ACTTCTGGTGGGAAGGAAAGAGG + Intronic
920273945 1:204789963-204789985 GCTGCTGGTGGGTGGCAGGGAGG + Intergenic
920779998 1:208980301-208980323 TATTCTGGTGGGAGGTACATGGG - Intergenic
921109345 1:212017518-212017540 GATTCTGGTGTGAGCCCCAGGGG - Intronic
921443929 1:215221985-215222007 GCTCATGGTGGAAGGCAAAGTGG + Intronic
922282233 1:224137037-224137059 GCTTCTGTGGCTAGGCACAGTGG - Intronic
923539463 1:234877598-234877620 TATTCTGGTGGGTGGCACAATGG + Intergenic
923712000 1:236395369-236395391 GCCTCTGGAGGGAGGTACCGAGG + Intronic
923808684 1:237288654-237288676 GCTGTTGTTGGGGGGCACAGTGG - Intronic
924136209 1:240969808-240969830 GGTTCTGCTGGGAGTCTCAGGGG + Intronic
1063367870 10:5502298-5502320 ACTTGTGGTGGGAGGCTGAGGGG - Intergenic
1063432706 10:6005103-6005125 GCTCCTGGTGGGAGGTGAAGGGG + Intergenic
1063676093 10:8141614-8141636 GCTTCCAGTGAGAGGCACATGGG + Intergenic
1064230009 10:13521576-13521598 GCTTTTGTGGGGAGGAACAGAGG + Intronic
1064648303 10:17482582-17482604 GCTTCAGGAGGGATGCACATGGG + Intergenic
1065813422 10:29463525-29463547 TCTTCCGGTCGGAGGCCCAGCGG + Exonic
1066703906 10:38157170-38157192 GGCTCTGGGAGGAGGCACAGCGG + Intergenic
1066986848 10:42475797-42475819 GGTTCTGGGAGGAGGCGCAGCGG - Intergenic
1067764661 10:49075828-49075850 GCTTCTGGTGGGTGGCACCAAGG + Intronic
1068114515 10:52722707-52722729 GCTCATGGTGGAAGGCAAAGGGG + Intergenic
1068836287 10:61557823-61557845 GCTCTTGGTGGGAGGGATAGTGG + Intergenic
1069634682 10:69918006-69918028 GCCTCTCCTGGGAGGCACAGTGG - Intronic
1069680907 10:70284266-70284288 GCTTCGGGAGGGAGGCAGGGGGG + Intergenic
1070345270 10:75535834-75535856 GCTTCTGGGAGGAGGCAGTGTGG + Intronic
1070581874 10:77726835-77726857 ACTTGTGGTGGAAGGCAAAGTGG + Intergenic
1070982843 10:80664075-80664097 ACTTCTGGTGCCAGGTACAGTGG + Intergenic
1071505493 10:86229168-86229190 GGTTCCCATGGGAGGCACAGAGG - Intronic
1072230908 10:93413301-93413323 TCTTCTGCTGCAAGGCACAGAGG - Intronic
1072290047 10:93956222-93956244 ACTTGAGGTGGGAGGAACAGTGG + Intergenic
1072653147 10:97311242-97311264 GCTACTGGTGGGAGGATCACTGG + Intergenic
1073284681 10:102380538-102380560 GCTTCTGGTGATGGACACAGCGG + Exonic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1076259603 10:129055005-129055027 GTTCCTGCTGGGTGGCACAGGGG - Intergenic
1076378847 10:130011391-130011413 GTTTCTGCTGGGACTCACAGGGG + Intergenic
1076671438 10:132122843-132122865 GGTTGTGGTGGGTGGCACTGGGG + Intronic
1076830590 10:132992391-132992413 GGTGCTGGTGGGATGCAGAGGGG + Intergenic
1077035102 11:490638-490660 GCTCCTGGTGGGACTCACACAGG - Exonic
1078559064 11:12354984-12355006 GCTGCTGGTGGGAGGCAGGCTGG - Intronic
1078596157 11:12688348-12688370 GTTTTTGGTGGGAGGCAGTGGGG + Intronic
1079177282 11:18153902-18153924 GCATCTGCTGGGAGCCACAGAGG - Intronic
1080443775 11:32318546-32318568 GGTGCTGGTGGGAGGCAAAGAGG - Intergenic
1080964086 11:37194451-37194473 ACTTCTGGTGGAAGGCAAAGAGG + Intergenic
1081439845 11:43067915-43067937 GCTTAGGGTGGGAGGGCCAGGGG + Intergenic
1081617251 11:44598168-44598190 GATTCTGGTGGGAGACACTGGGG + Intronic
1081673885 11:44957200-44957222 GCCTCTGGTGGGTGGCGGAGAGG - Intergenic
1082847904 11:57741325-57741347 GCTTCGGGTGGAGGGGACAGGGG - Intronic
1083996352 11:66274935-66274957 GCTTGAGGTGGGAGCAACAGTGG - Intronic
1084426633 11:69087598-69087620 GCCCCTGGTGGAAGGCACAGAGG - Intronic
1084428033 11:69096191-69096213 GTTCATGGTGGGAGGCCCAGGGG + Intergenic
1084451648 11:69242618-69242640 GCCTCTGGGGAGAGGAACAGAGG + Intergenic
1084454082 11:69257362-69257384 CCTTCTGGTGGGAGGGCCTGGGG + Intergenic
1084973054 11:72781751-72781773 GGCTCTGGTGGGAGGAGCAGTGG + Intronic
1085055461 11:73400744-73400766 TCTTGGGGAGGGAGGCACAGAGG - Intronic
1086407837 11:86514178-86514200 GATTATGGTGGAAGGCAAAGGGG - Intronic
1086850114 11:91798877-91798899 GATGGTGGTGGGAGGCAGAGAGG + Intergenic
1088727444 11:112652188-112652210 GTGTCTGCTGGGAGGTACAGGGG + Intergenic
1089297744 11:117480267-117480289 GCTTCTGAAGGGAGGGACACTGG - Intronic
1089674338 11:120079916-120079938 GATGGTGGTGGGTGGCACAGTGG + Intergenic
1090666480 11:128918174-128918196 GCCTGTGGAGGGAGGCCCAGGGG - Exonic
1090669135 11:128933945-128933967 ACTTTTGGTGAGTGGCACAGGGG - Intergenic
1090748541 11:129726485-129726507 GCTTCTGGTGGGAAGCAGGGAGG - Intergenic
1090846336 11:130532859-130532881 AATTGTGGTGGGAGGCAAAGTGG - Intergenic
1091842990 12:3633785-3633807 GCCTCTGGTGGCAGGGGCAGGGG - Intronic
1091899721 12:4135049-4135071 GTTTCTGGTTGGGGGCACGGAGG - Intergenic
1092052736 12:5484042-5484064 GTTTCCTGGGGGAGGCACAGGGG - Intronic
1092644503 12:10554838-10554860 GCTTGTGGTGGGAGGTATGGTGG + Intergenic
1093991138 12:25591285-25591307 GCTAGTGGTGGTAGCCACAGGGG - Intronic
1097177265 12:57150614-57150636 GGCTCTGGCTGGAGGCACAGAGG + Intronic
1097537394 12:60889378-60889400 GTTGTTGGTGGAAGGCACAGTGG - Intergenic
1099384570 12:81998800-81998822 TCCTGTGGTGTGAGGCACAGTGG - Intergenic
1101665173 12:106806232-106806254 GTTTCTGGGGACAGGCACAGTGG - Intronic
1101736398 12:107466447-107466469 GCTTGGGGAGGGTGGCACAGTGG - Intronic
1102458642 12:113086916-113086938 GCTTCAGGTGGGGGGCAGGGTGG - Intronic
1102630496 12:114274613-114274635 GCTTCTGGTGGGGGCCTCGGGGG + Intergenic
1103031979 12:117623040-117623062 GCTGCTGGTATGAGGCTCAGAGG + Intronic
1104266178 12:127234974-127234996 GATTCTGGTGGGGGGAAAAGAGG - Intergenic
1104693500 12:130845766-130845788 GCTCTTGTTGGGAGGCACAAGGG - Intergenic
1104810132 12:131615448-131615470 GCTTCTTCTAGGAGGCTCAGAGG - Intergenic
1104936451 12:132366832-132366854 GCTCCTGGTGGCAGGCCCCGGGG + Intergenic
1105347959 13:19591092-19591114 CCTTGTGGTTGGAGCCACAGGGG + Intergenic
1107275365 13:38672072-38672094 GCTTCTTCTGGGAGGGAGAGTGG - Intergenic
1109280003 13:60344988-60345010 ACTCATGGTGGAAGGCACAGTGG - Intergenic
1109330867 13:60927999-60928021 GCCTCTGGTGGGAGGCAATGTGG + Intergenic
1112257972 13:97852216-97852238 GCTCATGGTAGAAGGCACAGTGG + Intergenic
1113618245 13:111695933-111695955 GCTTCTGTTGGGAGGAAACGGGG + Intergenic
1113623776 13:111781194-111781216 GCTTCTGTTGGGAGGAAACGGGG + Intergenic
1114258144 14:21019563-21019585 GCGTCATGGGGGAGGCACAGAGG - Intronic
1115925478 14:38428788-38428810 TCTTCAGCTGGGAGGGACAGAGG - Intergenic
1116590659 14:46767731-46767753 ACCTCTGGTGGCAAGCACAGAGG + Intergenic
1117845360 14:59905994-59906016 GCTTATGGTGTAAAGCACAGGGG - Intergenic
1118895592 14:69943003-69943025 GCTGGTGGTGGGGGGCACAGTGG + Intronic
1121824773 14:97001105-97001127 GCTTCAGCAGGGAGGTACAGTGG - Intergenic
1122013165 14:98770361-98770383 GCCTCAGGTGGGAGGCAGTGGGG - Intergenic
1122993433 14:105249535-105249557 GCTTCTGAAGGGAAGCACACAGG + Intronic
1123021488 14:105399781-105399803 GCCTGGGGTGGGAGGCACTGGGG - Intronic
1123164758 14:106315557-106315579 GCTTCTGGAGGGAGGATTAGGGG + Intergenic
1123585939 15:21760746-21760768 GCTTCTGGAGGGAGGATTAGGGG + Intergenic
1123622580 15:22203336-22203358 GCTTCTGGAGGGAGGATTAGGGG + Intergenic
1125519787 15:40341221-40341243 TCTACTCATGGGAGGCACAGAGG - Intergenic
1125542691 15:40479482-40479504 GGCTCTGGCGGGAGTCACAGAGG - Intergenic
1128237892 15:66079946-66079968 GTTTCTCCTGGGAGGCACTGTGG + Intronic
1128957168 15:71960409-71960431 ACTTGTGGTGGAAGGCAAAGTGG - Intronic
1129035040 15:72643928-72643950 ACTTCTAGTGCGAGGCAAAGAGG + Intergenic
1129214842 15:74093288-74093310 ACTTCTAGTGTGAGGCAAAGAGG - Intergenic
1129390538 15:75218359-75218381 ACTCCTGGCGGGAGGCAAAGAGG + Intergenic
1129473732 15:75769274-75769296 ACTCCTGGCGGGAGGCAAAGAGG - Intergenic
1129731976 15:77937646-77937668 ACTCCTGGCGGGAGGCAAAGAGG - Intergenic
1132067260 15:98742416-98742438 GCTTGTGGTGGGGGGCAAGGTGG + Intronic
1132359936 15:101203708-101203730 GCTCCTGATGTGAGGCACTGAGG + Intronic
1132853213 16:2033986-2034008 GCTTCTGGACAGAGGCAGAGGGG + Intronic
1133257584 16:4526800-4526822 GCTTCTGTTGGAGGGCGCAGTGG - Intronic
1134183631 16:12066448-12066470 GGATCTGTTGGTAGGCACAGCGG + Intronic
1134566845 16:15258851-15258873 GCTTCTGGAGCCAGGCACTGTGG + Intergenic
1134687680 16:16169988-16170010 GCTTCTGGTGGGAGGCACAGCGG - Intronic
1134735648 16:16497848-16497870 GCTTCTGGAGCCAGGCACTGTGG - Intergenic
1134862585 16:17573940-17573962 CCTCCTGGAGGGAGACACAGTGG + Intergenic
1134931878 16:18214374-18214396 GCTTCTGGAGCCAGGCACTGTGG + Intergenic
1135574853 16:23577623-23577645 GCTCCTGATGTGAGGCACTGAGG - Intergenic
1135601154 16:23784716-23784738 GGTGCAGGTGGGAGGCTCAGAGG + Intergenic
1135883265 16:26279794-26279816 GGTACTGTTGGGGGGCACAGTGG - Intergenic
1136428090 16:30182822-30182844 GCTTCTGGAGGCAGCAACAGCGG - Intronic
1136619892 16:31421563-31421585 GTTTGGGGTGGGGGGCACAGAGG + Intronic
1137432947 16:48433315-48433337 GCTCCAGGTGGGAGTCACAGAGG - Intronic
1137715284 16:50594772-50594794 GCTGCTGGTGGGGAGCACATAGG + Intronic
1139288630 16:65837496-65837518 GCTTCTCTTAGGAGGCAAAGAGG + Intergenic
1139776006 16:69317368-69317390 GCTTCTGGTGCGGGGCATGGTGG + Intronic
1140900965 16:79367317-79367339 GCTGCTGGTTGAAGTCACAGGGG + Intergenic
1141150131 16:81558834-81558856 GCTGCAGGCGGGAGGAACAGTGG - Intronic
1141457790 16:84155515-84155537 GCTTCTTGGGCCAGGCACAGTGG - Intronic
1142124749 16:88404656-88404678 GCTGGTGGGGGCAGGCACAGAGG + Intergenic
1142201050 16:88761323-88761345 CCTGCTGGTGGGTGGAACAGTGG + Intronic
1142349711 16:89574590-89574612 GCTTCAGGGAGGAGGCGCAGAGG + Intergenic
1143480611 17:7225718-7225740 ACTGCTGGTGAGAGTCACAGTGG + Exonic
1143730284 17:8878557-8878579 GCTGCGGATGGGTGGCACAGTGG - Intergenic
1143768178 17:9151119-9151141 GCTTCTGGGGGAAGGGACAGGGG - Intronic
1144626039 17:16844937-16844959 GCTGCGGGTGGGAGGCAGAAAGG - Intergenic
1144880395 17:18427783-18427805 GCTGCGGGTGGGAGGCAGAAAGG + Intergenic
1145151840 17:20516604-20516626 GCTGCGGGTGGGAGGCAGAAAGG - Intergenic
1146561686 17:33875491-33875513 GATTCTGCTGGGAGGGGCAGTGG - Intronic
1147193068 17:38748338-38748360 GCTTGGGGTGGGAGGGAGAGGGG + Intronic
1147363154 17:39944002-39944024 CCTGCTGGTGATAGGCACAGGGG + Exonic
1147630605 17:41928562-41928584 GCTGCTGGGGCCAGGCACAGTGG + Intronic
1147643958 17:42022654-42022676 GCTTCTGGTGGGAGCCTCAGTGG + Intronic
1147725735 17:42565208-42565230 GCTTCTGGGGAGGGGAACAGAGG - Exonic
1148127198 17:45242959-45242981 GGCCCTGATGGGAGGCACAGGGG - Intronic
1149072492 17:52559164-52559186 GGGCCTGGTGGGAGGCACATTGG + Intergenic
1150969313 17:70009680-70009702 ACTTATGGTGGAAGGCAAAGTGG - Intergenic
1151048362 17:70948046-70948068 GCTGTGTGTGGGAGGCACAGTGG + Intergenic
1151375710 17:73687418-73687440 GCTCATGGTGGAAGGCAAAGGGG - Intergenic
1151630924 17:75310197-75310219 GATTGTGGTGGCTGGCACAGTGG + Intergenic
1152345991 17:79752204-79752226 GCTTCTGTTGGGAGACTCAGAGG + Intergenic
1152478619 17:80535183-80535205 GCTTGTGCTGGGAGTCACACAGG - Intergenic
1152892307 17:82889400-82889422 GGTGCTGCTGGGAGGCTCAGTGG + Intronic
1152931841 17:83113959-83113981 GCTGGTGGTGGGGGGCACAGAGG + Intergenic
1153380110 18:4428650-4428672 ACTCATGGTGGGAGGCAAAGTGG - Intronic
1153778357 18:8473434-8473456 ACTCATGGTGGGAGGCAAAGTGG + Intergenic
1153915174 18:9738548-9738570 GCTCCTGGAGGGCGGCGCAGGGG + Intronic
1155347078 18:24867765-24867787 GGTTCTGGTGAGAGGGGCAGAGG - Intergenic
1155767332 18:29652311-29652333 GCTGCTGGGGGATGGCACAGGGG - Intergenic
1156604933 18:38655163-38655185 ATTTCTGGTGGGAGGCCAAGGGG - Intergenic
1156713208 18:39974084-39974106 GCTTCTGGTGGGAGAGAGAAGGG - Intergenic
1156885233 18:42127881-42127903 GCTTCTGGTGAGAGAAACTGGGG - Intergenic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1157175397 18:45447095-45447117 GCTCCTGGTGGGAGGGATGGGGG + Intronic
1157525013 18:48374045-48374067 ACTCCTGGTGGAAGGCAAAGTGG - Intronic
1158328682 18:56337860-56337882 GCTCATGGTGGAAGGCAAAGGGG - Intergenic
1159088970 18:63824969-63824991 AATTATGGTGGGAGGCAAAGGGG + Intergenic
1159743248 18:72199781-72199803 TCTTCCGGTGGAAGGCAGAGGGG - Intergenic
1160010024 18:75100301-75100323 ACTTATGGTGGAAGGCAAAGAGG + Intergenic
1161605387 19:5212018-5212040 GCTTCTGGATGTAGGCATAGAGG + Exonic
1162494529 19:11016093-11016115 ACTCCTGGTGGAAGGCAAAGGGG + Intronic
1162872781 19:13598852-13598874 TCTTCTGGTGGGAGACACTGGGG - Intronic
1164283429 19:23789295-23789317 GCTGCTGGTGGCAGGCAGACTGG - Intronic
1164649719 19:29882968-29882990 CCATCTGCTGGGCGGCACAGCGG - Intergenic
1166431199 19:42729533-42729555 GCTTGTGATGGGAGAAACAGGGG - Intronic
1166447173 19:42868511-42868533 GCTTGTGATGGGAGAAACAGGGG - Intronic
1167284019 19:48588764-48588786 GGTGATGGTGGGAGCCACAGAGG + Intronic
1167385405 19:49160130-49160152 GTTTCTGGAGGGAGGAAGAGTGG + Intronic
1167728870 19:51238343-51238365 GCTCCACGTGGGAGACACAGAGG + Intronic
1167857246 19:52252633-52252655 GCTTCTGGTGGGTTTTACAGAGG - Intergenic
1168137319 19:54360272-54360294 GCTTGTGGTGGGAGGAGCAGAGG - Intronic
1168160758 19:54508813-54508835 GCTTGTGGTGGGAGGAGCAGAGG + Intronic
927050088 2:19319702-19319724 GCTGGTGGGGGGAGCCACAGAGG - Intergenic
927486483 2:23491741-23491763 GCATCTGGAGGGAGGGGCAGTGG - Intronic
929860328 2:45671575-45671597 GCTGGTGGGGGGAGGCAGAGGGG - Intronic
931039759 2:58284215-58284237 GCTTCAGGGGAGAGCCACAGGGG + Intergenic
931966557 2:67542551-67542573 GCTTCTGGTGAAATGCACTGAGG + Intergenic
932318289 2:70801094-70801116 GCTTCTCTTGGGAGGCACGAGGG - Intergenic
932951742 2:76301900-76301922 CCTTCAGGTGGGAGGGACTGAGG + Intergenic
934896004 2:98120612-98120634 GCTTCTGGTGGCAGGCCATGGGG + Intronic
936397858 2:112142564-112142586 GGGTCAGGTGGGAGGCACTGAGG + Intronic
936665215 2:114586885-114586907 GCTCATGGTGGAAGGCAAAGGGG - Intronic
936723165 2:115278585-115278607 ACTTATGGTGGAAGGCAAAGGGG + Intronic
936920300 2:117681766-117681788 AATTATGGTGGGAGGCAAAGGGG - Intergenic
937506220 2:122540296-122540318 GAATTGGGTGGGAGGCACAGTGG + Intergenic
938937031 2:136136195-136136217 GCTCCTGGTAGTGGGCACAGAGG - Intergenic
938984247 2:136558103-136558125 GGTTCTGGTGTGATACACAGAGG - Intergenic
939628854 2:144511077-144511099 TCATCTGGTGGGAGGCAAATGGG - Intronic
941468125 2:165854539-165854561 GCTTCTGGTGGCAGCAATAGTGG + Intergenic
942073891 2:172339368-172339390 GGTTCTGCTGGGAGGAAAAGGGG - Intergenic
943090609 2:183370128-183370150 GCAGCTTGTGGGAGGCCCAGAGG + Intergenic
945791457 2:214310603-214310625 GTTTGTGGTGGGATGCACTGAGG + Intronic
945946392 2:215999729-215999751 GCCCATGGTGGGAGGCACAGAGG + Intronic
946172811 2:217905564-217905586 GGTTTTGGTGGTTGGCACAGGGG - Intronic
946330835 2:219008431-219008453 CCTTCTGGTGGAAGACACTGTGG - Intronic
947873619 2:233453668-233453690 GCCTCTGGGTGGAGGAACAGGGG + Intronic
948652806 2:239459101-239459123 CCCTCTGGTGGGAGGCAGATGGG - Intergenic
948827230 2:240578552-240578574 TCCTGGGGTGGGAGGCACAGGGG + Exonic
948850782 2:240704352-240704374 GCTTGTGGAGGGAGGTGCAGTGG - Intergenic
1168800655 20:642064-642086 GCCTGTGGGGGGAGGCCCAGCGG + Intergenic
1169524472 20:6408406-6408428 ACTCATGGTGGGAGGCAAAGTGG - Intergenic
1169805618 20:9556549-9556571 GCCTCTGGTGGGAGTTTCAGGGG + Intronic
1169830033 20:9814996-9815018 ACTTATGGTGGAAGGCAAAGAGG + Intronic
1170569831 20:17626487-17626509 GCCTCTGCTGAGAGGCACACAGG + Intronic
1170598109 20:17820667-17820689 GCTGTTGGTGGGAGACACATGGG + Intergenic
1170771143 20:19333380-19333402 GATTCTGGTGGGAGCTTCAGTGG + Intronic
1172134132 20:32675839-32675861 GCTTCTGGAGGGTGGGGCAGGGG - Intergenic
1173928273 20:46797246-46797268 ACTTCTGGTGGGAAGGAGAGGGG - Intergenic
1175960130 20:62631685-62631707 GCACTTGGTGGAAGGCACAGCGG - Intergenic
1176033731 20:63026292-63026314 GCTTGCGGTGGGAGGGACGGTGG + Intergenic
1178003754 21:28193285-28193307 GTTCTTGGTGGGAGGCACTGAGG - Intergenic
1178031578 21:28533080-28533102 ACTCATGGTGGAAGGCACAGAGG + Intergenic
1178833683 21:36078050-36078072 GCATCTGGTGGGACACACGGAGG + Intronic
1179398923 21:41066302-41066324 GGATCTGGTTGGATGCACAGGGG - Intergenic
1179591121 21:42409242-42409264 CCTACTGGTGGGAGGCACTGCGG - Intronic
1179820949 21:43936443-43936465 TCTTCCGGAGGGAGGCACTGTGG - Intronic
1180961023 22:19762371-19762393 GCTTGTGAGGGGAGGCAGAGGGG + Intronic
1181265481 22:21628622-21628644 GCCGCCGGTGGGAGGCACACTGG + Exonic
1181442689 22:22944862-22944884 GCTTCTGCTCTGGGGCACAGAGG - Intergenic
1183136388 22:35892928-35892950 GCATTCAGTGGGAGGCACAGAGG - Intronic
1183408320 22:37640994-37641016 GCCTCAGCTGGGAGGGACAGTGG + Intronic
1184163424 22:42713173-42713195 GCTTCTGATGGAATGGACAGAGG - Intronic
1184288063 22:43483238-43483260 CGTTCTGGTGGGAGGCAAGGTGG - Intronic
1185338268 22:50280407-50280429 GCTGGTGGCGGGTGGCACAGCGG - Intronic
949093173 3:53848-53870 TCTTCTTTTGGGAAGCACAGAGG - Intergenic
949226312 3:1699810-1699832 GCTGATGGTGGGAGGCAGACAGG + Intergenic
949748816 3:7327343-7327365 CCTTCTGATAGGAGGCAGAGGGG - Intronic
950854190 3:16090068-16090090 GCTGCTGGTGGAAGGCTCTGAGG - Intergenic
951589014 3:24243345-24243367 GATCCTTGTGGGAGCCACAGTGG - Intronic
953277687 3:41519266-41519288 GCCTCTCCTGTGAGGCACAGAGG - Intronic
953296930 3:41728336-41728358 ACTTATGGTGGAAGGCAAAGGGG + Intronic
953917786 3:46931606-46931628 GCCCCTGGAGGGAGGCAGAGAGG + Intronic
953956540 3:47236018-47236040 GTCTCTGGTGAGCGGCACAGGGG - Exonic
953984520 3:47431104-47431126 GAAGCTGCTGGGAGGCACAGAGG + Intronic
954590172 3:51776315-51776337 GCTGCTGGTGGGACTCTCAGAGG - Intergenic
955938953 3:64129771-64129793 GCTGCTGGGGGGTGCCACAGGGG + Intronic
959851108 3:111087983-111088005 GCTTCTTCTGCCAGGCACAGTGG - Intronic
960124808 3:113986816-113986838 GCTTCTGTTTGGAGACAGAGGGG - Intronic
961907259 3:130275871-130275893 GTTTCTGGTCGGTGGAACAGGGG + Intergenic
964266327 3:154900053-154900075 GACTCTTCTGGGAGGCACAGAGG - Intergenic
965133885 3:164737464-164737486 GCTTCTGGTGAGAGCTTCAGGGG - Intergenic
965360794 3:167735486-167735508 GCTCCAGGTGTGAGCCACAGAGG + Intronic
965948086 3:174267274-174267296 ACTCATGGTGGGAGGCAAAGAGG + Intronic
967054335 3:185815753-185815775 GGTGCTGGTGGGAGGGAGAGAGG - Intronic
967651317 3:191990141-191990163 GCTGTTGTTGGGGGGCACAGTGG + Intergenic
967965901 3:194960162-194960184 CTTTCGGGTGGCAGGCACAGAGG - Intergenic
968111458 3:196051242-196051264 GCTTATGGGGGAAGGGACAGAGG + Exonic
968908572 4:3465453-3465475 GCTCCTGGTGTGAGGGAGAGAGG + Intronic
969453933 4:7290422-7290444 TCTTCTGGTGTGAATCACAGAGG + Intronic
970922236 4:21408397-21408419 GATTCTGCAAGGAGGCACAGAGG + Intronic
970973875 4:22020774-22020796 GCTTTTGGGGCCAGGCACAGTGG + Intergenic
971767163 4:30847368-30847390 CCTTCTGGTGTGAAGCACAAAGG - Intronic
971784587 4:31084561-31084583 GCTTCTAGTGAGGGGCTCAGGGG + Intronic
972104723 4:35468932-35468954 TCTACTGGCTGGAGGCACAGTGG - Intergenic
972425654 4:38930096-38930118 GCTCCAGGTGGGAGGAACTGTGG - Intronic
972634403 4:40870491-40870513 GCTTTTGGAGTGAGGCACACCGG - Intronic
973532702 4:51849249-51849271 TTTTCTGGGGGGATGCACAGTGG + Intronic
975008489 4:69320804-69320826 GTTACTGGTGGGAGGCAGATAGG + Intronic
975835986 4:78422631-78422653 GCATCTGGTGGGAGAGACAGAGG + Intronic
975900124 4:79141413-79141435 GATGCTGGTGGGAGGCACTTGGG + Intergenic
977426816 4:96876825-96876847 ACTTGTGGTGGAAGGCAAAGTGG + Intergenic
977504652 4:97886977-97886999 GATCCTGGTGGAAGGCAAAGGGG - Intronic
977746755 4:100558534-100558556 GCTGTTGGTGGGGGGCACGGTGG + Intronic
977804957 4:101286269-101286291 GCTACAGGTCGGAGGCCCAGGGG + Intronic
978763212 4:112377903-112377925 GGTTCTGATGGGAGGCACCAGGG + Intronic
982422097 4:155209479-155209501 GCTTTTGGTGGCAGGGAAAGAGG + Intronic
983000645 4:162409469-162409491 GCTGCTTCAGGGAGGCACAGTGG - Intergenic
983618842 4:169738082-169738104 CCTTCTGGTAGAAAGCACAGAGG + Intronic
984944331 4:184959514-184959536 GCTGCAGGTGGGAGGCAGTGGGG - Intergenic
985222286 4:187720408-187720430 TCTTCTGGAAGGAGGCAAAGAGG + Intergenic
985983594 5:3491890-3491912 TCTTCTGGTAGGAGACAAAGGGG - Intergenic
986307925 5:6529231-6529253 TGGTGTGGTGGGAGGCACAGGGG - Intergenic
986650874 5:9962176-9962198 AATTATGGTGGAAGGCACAGGGG + Intergenic
986773655 5:10994950-10994972 GCTTCTGGTGTGAACCACAGGGG + Intronic
986791658 5:11166982-11167004 GCTTCTTGTAGGAGTCCCAGGGG + Intronic
987075574 5:14379097-14379119 GGGTCTGGAGGGAAGCACAGGGG + Intronic
988077202 5:26367893-26367915 GCCTCTGGTGGAAGCAACAGTGG - Intergenic
988791308 5:34610347-34610369 ACTCATGGTGGAAGGCACAGCGG - Intergenic
991704624 5:69346328-69346350 GCTTCAGGTGGGGGGCGCGGGGG + Intergenic
994100086 5:95882480-95882502 ACTTATGGTGGAAGGCAAAGGGG + Intergenic
996381895 5:122870844-122870866 GCTGCTGGTGGATGGCACATTGG + Intronic
997791887 5:136769249-136769271 GGTGGTGGTGGGAGGCTCAGAGG + Intergenic
997803657 5:136891569-136891591 GATTTTGGTGGGTGGGACAGGGG + Intergenic
998041129 5:138951659-138951681 TCATCTGCTGGGTGGCACAGGGG - Intronic
999078213 5:148817615-148817637 CCTTCTCTTGAGAGGCACAGAGG - Intergenic
1000830069 5:166092198-166092220 ACTTATGGTGGAAGGCAAAGTGG + Intergenic
1001550712 5:172600569-172600591 GCATTGAGTGGGAGGCACAGAGG + Intergenic
1001797216 5:174512677-174512699 GCTGGTGGTGGGGGGCAAAGTGG + Intergenic
1001998886 5:176184650-176184672 TCTTCTGGTGGGAAACGCAGTGG - Intergenic
1002204356 5:177553057-177553079 GCTACCAGAGGGAGGCACAGAGG + Intronic
1002358214 5:178648255-178648277 GGTGCTGGTGAGAGGCACAGGGG + Intergenic
1003134494 6:3423876-3423898 ACTTCTGCTGGGAGCCTCAGGGG + Intronic
1003168837 6:3704399-3704421 ACTTCTGGTGGAAGGCAAAGGGG - Intergenic
1004472606 6:15942580-15942602 GCTTCTGGTGAGAGCCTCGGGGG + Intergenic
1004804195 6:19184148-19184170 ACTTATGGTGGAAGGCAAAGTGG - Intergenic
1006219849 6:32479468-32479490 CCTTCTGGTGGCCAGCACAGAGG + Intergenic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1006738773 6:36292970-36292992 GCTGGTGGTGGGTGGCCCAGGGG + Intronic
1006994654 6:38247504-38247526 GCTTCTCAGGGAAGGCACAGGGG + Intronic
1007180242 6:39924251-39924273 GCTTCTTGTAAGAGGCACAGTGG + Intronic
1007310080 6:40938377-40938399 GCTGCAGGTGAGAGGCAGAGTGG - Intergenic
1007387020 6:41527131-41527153 GTATCTGGTGAGAGGCAGAGAGG - Intergenic
1008199275 6:48565817-48565839 GCTCATGGTGGAAGGCAAAGAGG - Intergenic
1009607576 6:65894278-65894300 ACTTAAGGTGGAAGGCACAGTGG - Intergenic
1010123752 6:72409703-72409725 ACTCATGGTGGGAGGCAAAGTGG - Intergenic
1011093547 6:83633720-83633742 GCTGTTGCTGGGGGGCACAGTGG - Intronic
1011789763 6:90885623-90885645 GCTTTTGGCGGGGGGCACAGTGG - Intergenic
1011789771 6:90885646-90885668 GCTTTTGGCGGGGGGCACAGTGG - Intergenic
1013309497 6:108880029-108880051 GCTTCTGGTTAAAGGCACAAAGG + Intronic
1015128111 6:129777092-129777114 GATTATGGTGGGAGGCAAAGGGG + Intergenic
1015557118 6:134474557-134474579 GCTTCTGGTGGCAGGCTGATTGG + Intergenic
1018740155 6:166722391-166722413 GCAGGGGGTGGGAGGCACAGAGG + Intronic
1019695205 7:2442046-2442068 GCTTTGGGGGGGCGGCACAGTGG - Intergenic
1019829694 7:3315091-3315113 GCTTCTGGTGGCTTTCACAGTGG + Intronic
1020019107 7:4851833-4851855 GCTTCTGATGAGAGGCACAGAGG + Intronic
1021692887 7:23247689-23247711 GCTTCTGGTCAGAGCCGCAGAGG + Intronic
1022132993 7:27421236-27421258 GCTGCTGGTAGCAGGCACAGTGG + Intergenic
1022332889 7:29396975-29396997 GGTTCTGGTGGGAGGGACTGAGG - Intronic
1022448809 7:30494530-30494552 GCTTCTGCCGGGAGCCACTGGGG + Intergenic
1022491405 7:30822733-30822755 GCTTCAGGTGGGAGGATCACTGG - Intronic
1022802193 7:33787321-33787343 ACTTCTGGTTGGGGGCAAAGGGG - Intergenic
1023854987 7:44177416-44177438 GCAGCTGGGGGTAGGCACAGGGG - Intronic
1023977488 7:45041671-45041693 GCCTCTGGTAGCAGGCACAGAGG - Intronic
1024034631 7:45496907-45496929 GCTTCTGAAAGGAAGCACAGTGG - Intergenic
1024271937 7:47649240-47649262 GATTCTGGGGCCAGGCACAGTGG + Intergenic
1026435312 7:70391829-70391851 GCCTGTGTTGGGAAGCACAGGGG + Intronic
1027161583 7:75806531-75806553 GCTTCTGGGTAGAGCCACAGAGG - Intergenic
1027396951 7:77766470-77766492 GCCTGTGGTGGTGGGCACAGTGG - Intronic
1027419311 7:78004363-78004385 TCTTCTGGTGGGAAGGTCAGTGG + Intergenic
1029386944 7:100249371-100249393 CCTGGTGGTGGGAGACACAGTGG - Intronic
1030756705 7:113294890-113294912 GCTTCTGGTGGAATTCTCAGGGG - Intergenic
1034402057 7:150868847-150868869 GAAGCTGGTGGGAAGCACAGGGG - Intergenic
1034500937 7:151450363-151450385 GATTGTGGTGGTAGGCACACAGG + Intergenic
1034546604 7:151793687-151793709 CCCTCTGCTGGGAGGCACGGGGG + Intronic
1034683228 7:152947167-152947189 GCTGTTGGTGAGGGGCACAGTGG - Intergenic
1035078004 7:156193751-156193773 ACTTCTGCTGGGAGTCACAGAGG - Intergenic
1035230071 7:157460029-157460051 GCTTTTGGTTGCAGGCACAGTGG + Intergenic
1036632641 8:10526039-10526061 GGTGCTGATGGGAGCCACAGAGG - Intronic
1037990844 8:23320282-23320304 GCTTCTGCTGTGGGGCTCAGTGG - Intronic
1039880108 8:41620307-41620329 GCTGCTGCAGGGAGGCACGGGGG + Intronic
1039925572 8:41928848-41928870 GTTTCTGGTGGTAGGCAGTGAGG - Intergenic
1040427625 8:47304629-47304651 ACTCATGGTGGGAGGCAAAGTGG - Intronic
1040677362 8:49766438-49766460 GCATCTGGTGGAAGCCAAAGCGG + Intergenic
1041173663 8:55171306-55171328 GCGTCTGGTGGGAGACACAATGG + Intronic
1042755136 8:72202178-72202200 GATTATGGTGGAAGGCAAAGGGG - Intergenic
1043020755 8:74997002-74997024 GATTCTGGGGCCAGGCACAGTGG - Intronic
1043040760 8:75259478-75259500 GCTGTTGGAGGGAGGCACGGTGG + Intergenic
1044435948 8:92164521-92164543 GCTCTTGGCGGGAGACACAGGGG + Intergenic
1045103114 8:98865314-98865336 GCTTATGTTGGGAGGCTGAGAGG - Intronic
1045328269 8:101133529-101133551 GCTTCAGGTGGAGGACACAGCGG - Intergenic
1045791526 8:105989611-105989633 GCTCCTTGTGGGAGGCAGTGGGG + Intergenic
1048355924 8:133654046-133654068 GATTCTGGTGGGAGGCGTTGGGG + Intergenic
1048936550 8:139362394-139362416 GGCTCTGGTGGAAGGGACAGGGG - Intergenic
1049022415 8:139966454-139966476 GCTCCTGCAGGGAGGCACACAGG + Intronic
1049209556 8:141379209-141379231 GCTTCTGGTGGGAGGCGGTGGGG - Intergenic
1049266750 8:141671644-141671666 GGCTCTGCTGGGAGGGACAGAGG + Intergenic
1049778619 8:144417533-144417555 GCCTCTGTTGGGAGGGGCAGAGG - Intergenic
1051228199 9:14925007-14925029 GGGACTGGTGGGAGGCAGAGAGG + Intergenic
1051635527 9:19177852-19177874 GATTCTGGGGCCAGGCACAGTGG - Intergenic
1055131095 9:72775799-72775821 ACTCCTGGTGGAAGGCAAAGGGG + Intronic
1055723433 9:79201025-79201047 GCTGCTGCAGGGAGACACAGGGG - Intergenic
1056127029 9:83544310-83544332 GCTTCTGGTGAAATGCACAAAGG - Intergenic
1057223259 9:93269075-93269097 GCTGCAGGTGTGCGGCACAGAGG - Intronic
1057555680 9:96085758-96085780 GCATCTGGAGGGAGGCTCACGGG - Intergenic
1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG + Intergenic
1059054888 9:110969006-110969028 GTTTCTTGAGGGAGGCACATAGG - Intronic
1060823582 9:126674800-126674822 CCTGCAGGTGAGAGGCACAGCGG - Intronic
1061209291 9:129181548-129181570 GCTTCTGCTGGGATGCATAAAGG + Intergenic
1061423872 9:130487122-130487144 GGTTGTGCTGGGAGGAACAGAGG - Intronic
1062333237 9:136053685-136053707 GCTCCTGGTGGTGGGCGCAGTGG - Intronic
1186819686 X:13274708-13274730 ACTTTTGGTGGAAGGCACAGGGG - Intergenic
1187455747 X:19439956-19439978 GCAACCGGTGGGAGGCACTGGGG + Intronic
1187748356 X:22433491-22433513 GCTGTTGGTGGGGGGCACAGTGG + Intergenic
1187873512 X:23783639-23783661 GCTCCTGGGGGGATGCACATAGG - Exonic
1188597674 X:31921407-31921429 GGCTCTCGTGGAAGGCACAGAGG - Intronic
1189248542 X:39581988-39582010 GATCCTGGTGGAAGGCACAGAGG - Intergenic
1189946412 X:46184581-46184603 CTTTTTTGTGGGAGGCACAGAGG + Intergenic
1190060253 X:47206264-47206286 GCTTCCGGTAGTAGACACAGCGG - Exonic
1190222708 X:48522531-48522553 AAGTCTGGTGGGAGGCACATGGG - Intronic
1190245048 X:48685516-48685538 GTGTAGGGTGGGAGGCACAGTGG - Intronic
1190448897 X:50557903-50557925 GCTGTTGGGGGCAGGCACAGTGG + Intergenic
1191672141 X:63758015-63758037 GCTTCTGTTGGAAAGCACAATGG + Intronic
1192235708 X:69294248-69294270 GCTTCTGGAGGGAAGCCCTGGGG + Intergenic
1192361680 X:70444920-70444942 GCTTCTGGGCCGAGGCCCAGCGG - Intronic
1192601193 X:72466127-72466149 GCTGCTGCTGGGAGATACAGAGG + Intronic
1193533654 X:82686713-82686735 GCTTCTGGGGGAAGGGGCAGTGG - Intergenic
1193808264 X:86019058-86019080 GCTTCTGGGAGGTGGGACAGGGG + Intronic
1194206602 X:91018524-91018546 GCTCCTGGTGAGATGCACTGAGG + Intergenic
1194231545 X:91331230-91331252 AGTGCTGTTGGGAGGCACAGTGG + Intergenic
1197539803 X:127743926-127743948 TCTTCAGTTTGGAGGCACAGGGG - Intergenic
1198567561 X:137920221-137920243 GCATCTCCTGGGAGGCAGAGAGG + Intergenic
1199849791 X:151717297-151717319 GCTTCTTCTGGGAGGCACCCCGG - Exonic
1200231178 X:154444613-154444635 GTTTCTGTTGGGAGGCACGGCGG + Intronic
1200552352 Y:4593313-4593335 GCTCCTGGTGAGATGCACTGAGG + Intergenic
1201311045 Y:12598408-12598430 GCTGCTGGTGGCAAGGACAGTGG + Intergenic