ID: 1134687832

View in Genome Browser
Species Human (GRCh38)
Location 16:16171026-16171048
Sequence TAGCTTAGGGTGCCAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134687832_1134687834 -10 Left 1134687832 16:16171026-16171048 CCTTTCTCTGGCACCCTAAGCTA No data
Right 1134687834 16:16171039-16171061 CCCTAAGCTACTTCCCACCTCGG No data
1134687832_1134687840 21 Left 1134687832 16:16171026-16171048 CCTTTCTCTGGCACCCTAAGCTA No data
Right 1134687840 16:16171070-16171092 CACCTGCTGCTCTCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134687832 Original CRISPR TAGCTTAGGGTGCCAGAGAA AGG (reversed) Intronic
No off target data available for this crispr