ID: 1134689544

View in Genome Browser
Species Human (GRCh38)
Location 16:16182337-16182359
Sequence TTTGGGTCCCCGACTCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134689544 Original CRISPR TTTGGGTCCCCGACTCATCA TGG (reversed) Intronic
904598979 1:31663493-31663515 TTCAGGGCCCCCACTCATCATGG - Intronic
915891605 1:159779160-159779182 TTTGCTTCCCCTACTCACCAGGG - Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
918251279 1:182705797-182705819 TTTGTGCCCCTGACTCAGCAAGG + Intergenic
919819753 1:201465646-201465668 TTTGGGACCCCCACCCATCCAGG - Exonic
924550330 1:245070151-245070173 ATTGGTTCCCGGACTCCTCATGG - Intronic
924926452 1:248688555-248688577 TTTGTGTGCCTGACTCACCATGG + Intergenic
1070809931 10:79292657-79292679 TCTGGGCCCCCAACTCACCAAGG + Intronic
1071974117 10:90938052-90938074 CTTCTGTCCCCGACTCATAAGGG - Intergenic
1074143206 10:110695159-110695181 TTTGGGTCATCCACTCAGCAGGG - Intronic
1075219952 10:120576264-120576286 TTTGGGTCACAGACCTATCATGG - Intronic
1081862106 11:46339163-46339185 TGCGGGTCCACGACTCCTCAAGG + Intronic
1083704367 11:64503880-64503902 TCTGGGTCTCCCACTCTTCAGGG - Intergenic
1088722341 11:112605287-112605309 TTTTGGGCCTTGACTCATCATGG - Intergenic
1091341883 11:134822333-134822355 TTATGGTCCCCAAGTCATCATGG - Intergenic
1097516366 12:60612891-60612913 TATGCGTCCCTGACTCATTATGG + Intergenic
1105474113 13:20716621-20716643 TTTAGGTCCCAGACTCTTAATGG + Intronic
1111582689 13:90245202-90245224 CTTTGGTCCTAGACTCATCATGG - Intergenic
1113487714 13:110666478-110666500 CTGGGTTCCCCGACTCAACAGGG + Intronic
1117470391 14:56038772-56038794 TGTGGGTCCCTGACTCTTCTGGG + Intergenic
1123942843 15:25224902-25224924 TGTGGAACACCGACTCATCATGG - Intergenic
1126926983 15:53599971-53599993 TCTGAGTACCCTACTCATCATGG - Intronic
1129612175 15:77070107-77070129 TTTGGGTCCTTATCTCATCAGGG - Intronic
1134689544 16:16182337-16182359 TTTGGGTCCCCGACTCATCATGG - Intronic
1139587309 16:67912339-67912361 TTTGGTTCCCAGCATCATCATGG + Intronic
1140588049 16:76318046-76318068 TCTGAGTCCCTGACCCATCAGGG + Intronic
1141950123 16:87334639-87334661 TTTGGCTCCTGGACTCCTCACGG - Intronic
1143352434 17:6298526-6298548 CTTGGGTCCCCATCTGATCATGG - Intergenic
1167153885 19:47726292-47726314 TGTGAGTCCCTGACTTATCAGGG + Intronic
929884134 2:45863428-45863450 TTTGGGGTCCTGATTCATCACGG - Intronic
936486092 2:112927041-112927063 TTTGGGTCATGGAGTCATCATGG + Intergenic
939309205 2:140451607-140451629 TGTGGGGCCCATACTCATCATGG - Intronic
1170471031 20:16668438-16668460 TTTGGGTCTTCAAGTCATCAAGG + Intergenic
1180594082 22:16962367-16962389 CTTGGGTCCCCGGGTCAGCAAGG + Exonic
1182828440 22:33285197-33285219 TTTGGGTCTCAGGGTCATCATGG + Intronic
953768608 3:45762253-45762275 TGTGGGTGCCAGACTCATCTGGG + Intronic
962407581 3:135113141-135113163 TTTGGGTCCCCGCCCCATGCTGG + Intronic
968981271 4:3850967-3850989 TCTGGGTCACCCACCCATCATGG + Intergenic
982331604 4:154187183-154187205 TTTGGGTCCCCCAGGCTTCAGGG - Intergenic
991452399 5:66766961-66766983 TGTGGGTCCCTGAGTCACCACGG - Intronic
999687667 5:154117203-154117225 TGTGGGTCCCCTCCTCAGCATGG - Intronic
1008720513 6:54344401-54344423 TGTGGGTCCCTGACACATCAAGG - Intronic
1038700713 8:29847070-29847092 TTTCGGTCCCTGAGTCATCCTGG - Intergenic
1041402660 8:57461585-57461607 GTTGGGTCCCAGACACACCATGG - Intergenic
1042876370 8:73443979-73444001 TCTGGGTCCCTGACTGACCAGGG - Intronic
1043203974 8:77411915-77411937 TTAGGCTTCCAGACTCATCAGGG - Intergenic
1044463994 8:92482617-92482639 TTTAGGTCCCTGAATTATCAAGG + Intergenic
1053293522 9:36897639-36897661 TTTGGGTCCTGGACCCAGCATGG + Intronic
1061979209 9:134090502-134090524 TTTGGGGCCTTGGCTCATCACGG - Intergenic