ID: 1134690676

View in Genome Browser
Species Human (GRCh38)
Location 16:16189239-16189261
Sequence GGGGAGAACCTAATGCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134690670_1134690676 6 Left 1134690670 16:16189210-16189232 CCCACGGCTCTAGGCATCACTAG No data
Right 1134690676 16:16189239-16189261 GGGGAGAACCTAATGCCTCTAGG No data
1134690669_1134690676 7 Left 1134690669 16:16189209-16189231 CCCCACGGCTCTAGGCATCACTA No data
Right 1134690676 16:16189239-16189261 GGGGAGAACCTAATGCCTCTAGG No data
1134690671_1134690676 5 Left 1134690671 16:16189211-16189233 CCACGGCTCTAGGCATCACTAGA No data
Right 1134690676 16:16189239-16189261 GGGGAGAACCTAATGCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134690676 Original CRISPR GGGGAGAACCTAATGCCTCT AGG Intronic
No off target data available for this crispr