ID: 1134694608

View in Genome Browser
Species Human (GRCh38)
Location 16:16214330-16214352
Sequence CTGGGGGTCTTCAGGGAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 2, 1: 0, 2: 5, 3: 55, 4: 463}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134694598_1134694608 26 Left 1134694598 16:16214281-16214303 CCTCAAAGTGGAACAGGAATGAG 0: 2
1: 0
2: 1
3: 26
4: 237
Right 1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG 0: 2
1: 0
2: 5
3: 55
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134694608 Original CRISPR CTGGGGGTCTTCAGGGAAGA AGG Exonic
900183784 1:1323952-1323974 CTGGGGGTCTGCTGGGCTGAGGG + Intronic
900326641 1:2111455-2111477 CTGGGTGTCTCCAGAGAAGCTGG + Intronic
900630760 1:3633962-3633984 CTGGGGCTCTTCAGGGGCGTAGG - Intronic
900950264 1:5854656-5854678 CTGGGGGCTGTTAGGGAAGAAGG - Intergenic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
901573323 1:10179719-10179741 CTGGATGTCTGCAGGGAAAAAGG - Intronic
901857363 1:12052909-12052931 CTGGGGTTCATCAGTGAACAAGG - Intergenic
901921266 1:12539489-12539511 CTGGGGCTCTTCTGGGCTGAAGG - Intergenic
902916273 1:19641578-19641600 CTCGGGGTCTGCATGAAAGATGG + Intronic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
903643582 1:24876700-24876722 CTGGGAGTCATGAGGGAGGATGG - Intergenic
903662008 1:24984106-24984128 CTGGGTGGGTTCAGGGATGAGGG + Intergenic
904320929 1:29697465-29697487 CTCGGGGTGTGCAGGGTAGATGG - Intergenic
904328947 1:29745469-29745491 CTGGGGGGCTTCGGGGATGGAGG - Intergenic
904417552 1:30372556-30372578 CTGGGGGGCTTCAGGGATGAAGG + Intergenic
904616153 1:31751012-31751034 CTGGGCGTCTTGGGGGAAGCAGG - Intronic
904822614 1:33255851-33255873 CTGGGGGTCTCCCTCGAAGACGG - Intergenic
905227235 1:36487219-36487241 CAGGGTGGGTTCAGGGAAGAAGG - Intergenic
905422668 1:37859313-37859335 CTGGGGGTCTCCAAGCAAGGAGG + Intronic
905459767 1:38114872-38114894 CTTGGGGCCTTCAGGGATGAAGG + Intergenic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
905674902 1:39818331-39818353 CGGGGGTTCTGCTGGGAAGAAGG + Intergenic
908533660 1:65057273-65057295 TTAGGAGTCTACAGGGAAGAGGG + Intergenic
910689949 1:89955455-89955477 ATGAAGGTCTTCAGGGAAGAGGG - Intergenic
912840143 1:113032294-113032316 CTGGCTGTCTTAAGGGAAAAGGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
915249401 1:154577694-154577716 CTTGGTTTCCTCAGGGAAGAGGG - Exonic
915564811 1:156707388-156707410 CTGGGCTTCTGCAAGGAAGAGGG + Intergenic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915920924 1:159974563-159974585 CTGGGAGCCTTTAAGGAAGAAGG - Intergenic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916282247 1:163064577-163064599 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
916909239 1:169327249-169327271 GTTGGAATCTTCAGGGAAGAAGG - Intronic
917164056 1:172091599-172091621 CTGGAACTCTTCAGGGAACAAGG + Intronic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
917636606 1:176943220-176943242 CTGGGGGTCTTCAGAGACACAGG + Intronic
918210032 1:182342329-182342351 TTGGGCATCTTCAGGGAACAAGG + Intergenic
918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG + Intergenic
918276919 1:182961720-182961742 TTGGGGGTTGCCAGGGAAGAGGG + Intergenic
919813052 1:201420996-201421018 CTGGGGGTCCTCTTGGAGGAAGG - Intronic
919983207 1:202655458-202655480 CTGAGAGTCTTCAGGGACAAGGG + Intronic
920304956 1:205012818-205012840 CTTGGGGTCTTCAGGGCCAAGGG - Exonic
920581549 1:207113048-207113070 CTGGGGCTCTTCATAGAAAAAGG + Exonic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
921764105 1:218950448-218950470 AAGGGGGTCTTAAGGGAAAAAGG - Intergenic
923276011 1:232396986-232397008 CTGGAGATTTTCAGGGAATAAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923529272 1:234800781-234800803 CTGGGGTTCTTCTGTAAAGACGG + Intergenic
923950579 1:238947505-238947527 CTGGGGGCCATCAGTGAAGTTGG + Intergenic
1063440940 10:6072475-6072497 CTGTGGGTCTTTATGGATGAGGG - Intergenic
1064017760 10:11786017-11786039 CAGAGGGTTTTCAGGCAAGAGGG - Intergenic
1065738068 10:28771968-28771990 CTGGGCGGCTGCAGGGCAGAGGG - Intergenic
1068803059 10:61163320-61163342 TTGGAGGTCTGCAGGGCAGAAGG + Intergenic
1069722704 10:70559960-70559982 CTGGGGGTCTGCAGAGAACTTGG - Intronic
1070559459 10:77554858-77554880 CTGGGGGTCTTAGGGAAAGGGGG + Intronic
1071033693 10:81216379-81216401 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1072071436 10:91921879-91921901 CTGGGAGCCTTCCAGGAAGAGGG - Intergenic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073510548 10:104039991-104040013 CTGGGGGACCTGAGGGAAAAAGG + Exonic
1073552271 10:104414592-104414614 TGGGTGGGCTTCAGGGAAGATGG + Intronic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074428202 10:113370646-113370668 CTGGCTGGCTTCATGGAAGAGGG + Intergenic
1075934536 10:126328082-126328104 CTAGGGGCCAGCAGGGAAGATGG - Intronic
1076202424 10:128569178-128569200 CTGGGGGTCTTGGTGGCAGATGG - Intergenic
1076751480 10:132545587-132545609 GTGGGGGCCTTAGGGGAAGAGGG + Intronic
1077278970 11:1733400-1733422 GAGGGGGTGCTCAGGGAAGAGGG - Exonic
1077915824 11:6611003-6611025 CTTGCGGTCCTGAGGGAAGAGGG + Exonic
1077924813 11:6671174-6671196 CTAGGAGTGTTCAGTGAAGAAGG + Intergenic
1078205963 11:9229637-9229659 CTGAGGGTCTTCAAGGAAAAGGG - Intronic
1078256184 11:9661111-9661133 ATGGGGGTCATCTTGGAAGATGG - Intergenic
1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG + Intronic
1078852401 11:15176863-15176885 CTGGGAAGCTTCAGGAAAGAAGG - Intronic
1079058531 11:17228221-17228243 CTGGGGTTTTTAAGGGAACATGG - Intronic
1080505723 11:32911282-32911304 CTGGGGGTGGTGGGGGAAGACGG + Intronic
1080953965 11:37071098-37071120 TGGGGGGTCTTGGGGGAAGAAGG - Intergenic
1083106337 11:60361787-60361809 CTGGTTCTCTTCAGGGAAGGAGG - Intronic
1083285116 11:61653680-61653702 ATAGGGGTCTTCAGGGGAGAAGG - Intergenic
1083768864 11:64855271-64855293 CTGGTGGCCATCAGGGCAGAAGG - Intronic
1084444882 11:69197749-69197771 CTGGGTGGCCTCAGGGAAGATGG + Intergenic
1085462418 11:76702127-76702149 CTGGGGGTGTTCACGGAGGATGG - Intergenic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1087903011 11:103663830-103663852 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1088919484 11:114250940-114250962 CTGGGGGTCTTGGTGGAGGAAGG - Intergenic
1089383440 11:118052368-118052390 CTGGGGCCCTGCAGGGAAGCAGG + Intergenic
1089608555 11:119656517-119656539 GTGGGGGCTTTCAGGGATGAGGG + Intronic
1089638443 11:119831615-119831637 GTGGGGGTCTTAAGGGATGGAGG - Intergenic
1090844658 11:130520505-130520527 CTGGGAGGCGTCAGGGAGGAAGG + Intergenic
1090883775 11:130858261-130858283 ATGGGGGTCTTCAGGGACTAAGG + Intergenic
1091440096 12:505869-505891 CTAGGGCTCTTCATGGGAGAGGG - Intronic
1091683125 12:2540962-2540984 CTGAGGGTCATGAGGGAAAAGGG + Intronic
1091879352 12:3964397-3964419 CTGGGGCGCTTCAGGAATGAAGG - Intergenic
1092163263 12:6327707-6327729 CTGGGAGTCCTCAGGGGAGGAGG + Exonic
1092166979 12:6348345-6348367 TCGGGGGTCTTCAGGGATGAAGG - Intronic
1092874555 12:12836773-12836795 CTGTGTGTCTTCAGATAAGAAGG - Intergenic
1094317693 12:29150090-29150112 CTGGGGGTGTGCAGGGGAGCAGG + Intronic
1096021367 12:48328533-48328555 TGGGGAGTCTTCAGTGAAGAAGG + Intergenic
1096212671 12:49778436-49778458 CTGAGGGATTTTAGGGAAGAAGG - Intergenic
1096743205 12:53709528-53709550 TTGGGGGGCTTCATGGAGGAGGG + Intronic
1097160951 12:57046428-57046450 CTGGGAGGCTCAAGGGAAGAGGG + Intronic
1097534384 12:60847979-60848001 CTGTGGGACTTCAGGGACAAGGG + Intergenic
1101267375 12:103103272-103103294 ATGGCTGTTTTCAGGGAAGATGG - Intergenic
1101879839 12:108618657-108618679 CTGGGGGTGCTGATGGAAGAAGG - Intergenic
1102254447 12:111407443-111407465 CTGTGGGTCTCCAGGGATGCAGG + Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102541445 12:113622332-113622354 CTGGAGGCCTGCAGGGAAGCTGG + Intergenic
1104448571 12:128852587-128852609 CTGGGGTTCATCAGGGTACATGG - Intergenic
1105696805 13:22897462-22897484 CGGGGGGTCTCCTTGGAAGAGGG + Intergenic
1105746659 13:23383502-23383524 CTGGGGCTGTTCAGGAAGGAGGG - Intronic
1105847313 13:24304556-24304578 GTGGGGGGCTGCAGGGGAGAAGG - Exonic
1106800818 13:33254531-33254553 CTGTGGGTCTTCAGGCTTGATGG - Intronic
1107001467 13:35550490-35550512 CTGAGGGACTTCACGGAAAATGG + Exonic
1108385710 13:49897576-49897598 TTGTTGGTCTCCAGGGAAGAGGG - Intergenic
1108691147 13:52860395-52860417 CTGGAGGCTCTCAGGGAAGAAGG - Intergenic
1112471789 13:99695860-99695882 ATGAGGGTCTTCAGGGGAGGAGG + Intronic
1114332439 14:21651035-21651057 CTTGGGCCCTTCAGGGATGAAGG - Intergenic
1115442625 14:33453762-33453784 CTGTGGGTCTCCAGGTAAGGAGG - Intronic
1115495623 14:34001539-34001561 CTGGGGCTTTCCAGGGAGGAAGG + Intronic
1115523614 14:34257611-34257633 ATGAGAGTCTTCAGGGGAGAAGG - Intronic
1117210926 14:53498873-53498895 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1117804173 14:59473367-59473389 ATGGGAGTTTTCAGTGAAGATGG + Intronic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1120766066 14:88327164-88327186 CTTCTGGACTTCAGGGAAGAAGG - Intergenic
1121702286 14:95963641-95963663 CTGGGGGTCTTGTGGAAACATGG + Intergenic
1122205239 14:100145069-100145091 CTGGGGGGCGGCAGGGAAGCGGG - Exonic
1122787130 14:104168939-104168961 CTGGGGGTCTGCGGGGAACAAGG + Intronic
1122811487 14:104291523-104291545 CTGGCGGCCTTCGGGAAAGAAGG - Intergenic
1122914813 14:104853950-104853972 CTGCGGTTCATCAGGGAAAATGG - Intergenic
1123810034 15:23915572-23915594 CTGGGTGTCAACAGGGAAGTTGG - Intergenic
1123947314 15:25245023-25245045 CTGGGGTTTTTCAGGGGAGCCGG + Intergenic
1123948514 15:25250414-25250436 CTGGGGTTGTTCAGGGGAGCTGG + Intergenic
1124992719 15:34691892-34691914 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1127701389 15:61504812-61504834 CTGCGGGTCTTTGGGCAAGAGGG + Intergenic
1128075453 15:64822788-64822810 ATGGGGGTCTTCAGGGCACAAGG - Intronic
1128468600 15:67933268-67933290 CTGAGGGTTTTCAGGAGAGAAGG - Intergenic
1128578299 15:68791067-68791089 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1129792674 15:78351994-78352016 CTGGGGGTTTTGAGGGGAAATGG + Intergenic
1130982178 15:88820329-88820351 ATGGGGGACTTCATGGAGGAAGG + Intronic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1132007500 15:98242413-98242435 CTGGTGGCCTTAAAGGAAGAGGG - Intergenic
1132180615 15:99750140-99750162 ATGAGGGTCTTCACGGGAGAAGG - Intergenic
1132655886 16:1041501-1041523 CTGAGAGTCTCAAGGGAAGAAGG - Intergenic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133149024 16:3812632-3812654 CTGGGGGTCATCAGGGAACTTGG - Intronic
1133332549 16:4984162-4984184 GTGGGGGTGTTGAGGGATGAGGG - Intronic
1133371551 16:5249239-5249261 CTGGGGGCCTTCAGGAAGGATGG + Intergenic
1133727961 16:8554936-8554958 CTGGGGGTCTGCAGAGCATAGGG - Intergenic
1134300013 16:12982540-12982562 CTGGGGGACTTCAGGGAATTGGG - Intronic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1137702614 16:50507801-50507823 CTGGGTGTCTTCTGGCATGAGGG + Intergenic
1137808258 16:51328494-51328516 GTGGGGGTAGTCAGGGGAGATGG - Intergenic
1138533470 16:57647349-57647371 CTGGGGGCCGTACGGGAAGAGGG + Intronic
1140116950 16:72050394-72050416 CTGTGGGTCCTCAGGGAAGTGGG - Intronic
1140335133 16:74097942-74097964 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1140560300 16:75972401-75972423 CAGGGGATATTCTGGGAAGAGGG + Intergenic
1140657438 16:77155304-77155326 CTGGGGCTCTTCAGGGAAGCTGG + Intergenic
1140925862 16:79582880-79582902 TGGGGGGCCTTCAGTGAAGATGG + Intergenic
1141693191 16:85607829-85607851 GTGGGGGCCTCAAGGGAAGAAGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141861353 16:86718584-86718606 CCCGGGGTCTGCAGGGAAGCAGG - Intergenic
1142235845 16:88922173-88922195 CTGAGGGTCTTCACCCAAGAGGG + Intronic
1142376010 16:89707490-89707512 CTGGGGAGCATCAGGGAAGAGGG - Exonic
1142966471 17:3585085-3585107 CTGGGGGTCCCCAGGGATGTGGG - Intronic
1143020924 17:3916842-3916864 CTGGGGGTCTGCAGCGAGCAAGG + Intergenic
1143021848 17:3921010-3921032 CTGGGGGTGCTGAGGAAAGATGG - Intergenic
1143303069 17:5925238-5925260 CTGCGGGACTCCAGGCAAGAGGG - Intronic
1143373194 17:6453184-6453206 CCTGGGGTTCTCAGGGAAGAGGG + Exonic
1143383166 17:6508844-6508866 CTGGCGGTTTCCAGGGAAGATGG - Intronic
1143431967 17:6894270-6894292 TTTGGGGTCTTCAGGGAGGACGG - Intronic
1143792385 17:9307912-9307934 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1144071186 17:11672504-11672526 CTGGTGATTTTGAGGGAAGATGG - Intronic
1144232319 17:13220471-13220493 CTGCTGGGCTTCTGGGAAGAGGG + Intergenic
1144409950 17:14991206-14991228 CTCGGGGTCTTGAGGAAAAATGG - Intergenic
1144511820 17:15883532-15883554 ATTGGGGTATTCAGAGAAGAAGG + Intergenic
1145045757 17:19614261-19614283 CTGGAGCTCTACTGGGAAGACGG + Intergenic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1146695641 17:34907565-34907587 CCAGGGGTCTTCTGGGAGGAGGG - Intergenic
1147186277 17:38714988-38715010 TAGGGAGGCTTCAGGGAAGAGGG + Intronic
1147588949 17:41668909-41668931 TTGGGGGACTTCAGTGAATACGG + Intergenic
1147760451 17:42794760-42794782 CTGGAGCTCTTCTGGGAAGGAGG - Exonic
1148162040 17:45455781-45455803 CTGAGGGACTACAGGGGAGAAGG - Intronic
1148205774 17:45778982-45779004 CTGGGGGGCTGCAGGGGAGGGGG - Intergenic
1149598553 17:57878429-57878451 CTGGGGCTGTTCTGGGGAGAAGG + Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150122337 17:62614567-62614589 CAGGCGATCTTAAGGGAAGATGG + Intronic
1150133475 17:62681507-62681529 CTGGGGGGCTTGAGGCAGGAAGG + Intronic
1151010742 17:70492707-70492729 CTGGGGGACTTGGGGGAAAAGGG + Intergenic
1151683092 17:75631894-75631916 ATGGGGGTCTCCCGGGAAGCAGG + Intronic
1151719294 17:75846474-75846496 CTGGGGCTCTTCTGGGAGCACGG - Exonic
1151889613 17:76944427-76944449 CTGGGGGTCTTGCGGGGACAAGG - Intronic
1152175045 17:78782003-78782025 CAGGGGGTTTTGAGGGATGAGGG - Intronic
1152540271 17:80971253-80971275 CTGGGGGGCTGCATGGACGATGG - Intergenic
1152595282 17:81234782-81234804 CTGGGCTCCTGCAGGGAAGATGG - Intronic
1153333319 18:3896860-3896882 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1153487606 18:5615967-5615989 CTGGGGGTCTTCCAGAAGGAAGG + Intronic
1154161877 18:11986514-11986536 CTCTGGCTCTTCAGGGCAGAAGG + Intronic
1156245438 18:35293476-35293498 CTGTAGGTCTTCAGGGACCAGGG + Intergenic
1156362650 18:36398046-36398068 CTGGGGTTCTTCTAGTAAGAAGG + Intronic
1156580696 18:38371342-38371364 TTGAAGGTCTTCAGGGAAGCTGG + Intergenic
1156637803 18:39051933-39051955 ATGGGAGCCTTCATGGAAGAGGG - Intergenic
1157015203 18:43703891-43703913 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1157492054 18:48130343-48130365 CTGGGGGCTTTAAGGGAAGTGGG + Intronic
1157728728 18:49985738-49985760 CTTAGGGTTTTCAGGGAAGAGGG - Intronic
1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG + Intronic
1158978380 18:62734312-62734334 CTCTGGATCTTCATGGAAGAAGG + Intronic
1159005074 18:63004115-63004137 CTGGGGGTCAGCAAGGAAGCTGG + Intergenic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1160491330 18:79338454-79338476 CTTGGGGAGTTCAGGGAAGGTGG - Intronic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160895524 19:1400293-1400315 CTGGGGGTCTGCTTGGAGGAGGG + Intronic
1160967483 19:1753071-1753093 CTGGGGGTCTGTAGGGAACGGGG + Exonic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161112730 19:2479098-2479120 CTTGGGGGCTGCAGGGCAGAGGG - Intergenic
1161207275 19:3047466-3047488 CAAGGGGTCTTCTCGGAAGAAGG - Intronic
1161738336 19:6005448-6005470 CTGGGGGTCGTCAAGGAAGCTGG - Intronic
1161979728 19:7624179-7624201 CTGGGGGCCAGCAGGGAAGGAGG - Intronic
1162058730 19:8081529-8081551 CTGGGGGTGTTCAGGGACTGAGG + Intronic
1162589835 19:11584221-11584243 CTTGGGGGCTGCAGGGAAGGGGG + Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163039579 19:14592384-14592406 CTGGGGGAATACAGGGAACAGGG + Intronic
1163748011 19:19059427-19059449 CTGGGAGTCTCCAGGGAGGAGGG - Intronic
1164044846 19:21528203-21528225 GTGGGGGTCCTCAGTAAAGATGG + Intronic
1164161418 19:22627779-22627801 TTGGGGGACTTCAGGGAATGAGG - Intergenic
1164518764 19:28960616-28960638 CTGTGGGTCTTCAAGGCAGCAGG + Intergenic
1165143630 19:33717992-33718014 CTGGGGGTCTTCTGCCAGGATGG - Intronic
1165272793 19:34724892-34724914 CTGGGGTTTTTCAGAGAAGGGGG - Intergenic
1165331317 19:35142537-35142559 CTGCGGGTATTCTGGGGAGAGGG + Intronic
1165668685 19:37655875-37655897 CTGGGGCCCTTCAGGGAGCAAGG + Intronic
1166198909 19:41223603-41223625 CTGGGGGTCTCCAGGGTGGAGGG + Intronic
1166546318 19:43636423-43636445 CCTGGGCTCTTCTGGGAAGAGGG - Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1167514522 19:49915307-49915329 CAGGGGTTCTTCAGGGAGGCAGG + Intronic
1167651563 19:50733137-50733159 CTGGGGGTTTTTTGGGGAGAGGG - Intergenic
1167700134 19:51038522-51038544 ATGAGGGTCTTCAGGGGAAAAGG - Intergenic
1167707508 19:51090320-51090342 CTGAGGGTCGCCAGGGCAGAGGG + Intergenic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
925021601 2:574002-574024 CGGTGGGTTTTCAGGGAGGAGGG - Intergenic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
925094499 2:1185284-1185306 CTGTGGGTCTTCCAGGAACATGG + Intronic
925185613 2:1844213-1844235 CTGGGGGTGTTCAGTGCTGAAGG - Intronic
926111712 2:10188101-10188123 CTCGGGGTCCTCAGGGAAGCAGG - Intronic
926202789 2:10813350-10813372 CTGGGGTTCTCCAGAGAAGGAGG - Intronic
926226679 2:10971784-10971806 ATGGGGGAGCTCAGGGAAGAGGG + Intergenic
926304767 2:11629882-11629904 CCTGGGGTCTTCTGGGAAGCAGG + Intronic
927487724 2:23500238-23500260 CAGGAGGGCTTCATGGAAGAGGG + Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929764204 2:44830857-44830879 CTGGTGGTCTTTCGGGAAGGTGG - Intergenic
930417136 2:51103278-51103300 TTGAGTGTCCTCAGGGAAGAGGG - Intergenic
930612270 2:53555640-53555662 CCGGGTGTCTGCAGGGCAGAGGG + Intronic
931090827 2:58884182-58884204 CAGGAGGTATTCAGAGAAGACGG + Intergenic
931143003 2:59484453-59484475 GTGGGGGGCATCAGGGAAGTGGG - Intergenic
932184192 2:69677879-69677901 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
932827653 2:74956609-74956631 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
933374979 2:81467459-81467481 CGGGGCGTCTGCAGGGCAGAGGG + Intergenic
934028905 2:88023969-88023991 CTTGGGGTTTTCAGAGAAGAAGG + Intergenic
935376758 2:102408053-102408075 CTGGGGGTTCTTAGGGAGGAGGG + Intergenic
935384393 2:102485779-102485801 CTTGGGGGCTTGAGGAAAGAGGG - Intronic
935595490 2:104874160-104874182 CTGCGGGTCTCCTGGGAGGAAGG + Intergenic
936650767 2:114423473-114423495 CTGGTGAACCTCAGGGAAGAAGG + Intergenic
936948138 2:117949780-117949802 TTGGGGGTCTTAGGGCAAGAAGG - Intronic
937092801 2:119217747-119217769 TTTGGGGCCTCCAGGGAAGAGGG - Intergenic
937231619 2:120401286-120401308 TGGGGGTTCTTCAGGGCAGAGGG + Intergenic
937241456 2:120465082-120465104 CTGGGGGGCTCCATGGCAGAAGG - Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
937891819 2:126944940-126944962 TTGAGGGTCTTCAGGGCAGAAGG + Intergenic
937914768 2:127093435-127093457 ATGAGGGTCTTCAGGGGTGAAGG - Intronic
938870743 2:135473750-135473772 CTGGGGGTCTAAAAGAAAGATGG - Intronic
940206911 2:151213167-151213189 GTGGTGGTTTCCAGGGAAGAGGG + Intergenic
941877292 2:170447053-170447075 ATGAGGGTCTTCAGGGGAGAAGG + Intronic
941924982 2:170885615-170885637 CTTGGGGACTTCAGGAATGAGGG - Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944994980 2:205283838-205283860 CTGGCTTACTTCAGGGAAGAGGG - Intronic
945218473 2:207460457-207460479 ATGAGGGTCTTCAAGGAAGAAGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946434457 2:219642535-219642557 CTGGGGGACTTGAGGGGAGCGGG + Intergenic
947079583 2:226381188-226381210 CTGGGGTTCTCCAGAGAGGAAGG - Intergenic
947614738 2:231548549-231548571 GTGGGTGTCTCCAGGGGAGACGG + Intergenic
948130970 2:235600399-235600421 ATGGGGGTCTATAGGGCAGAGGG - Intronic
948713962 2:239847017-239847039 ATGTGGGTTTTCAGGGAAGTGGG - Intergenic
948868925 2:240788674-240788696 CTGGGGGTCATCCTGGAAGGAGG + Intronic
1169048596 20:2558203-2558225 CAGGAGGTCTTCAAGGGAGACGG + Intronic
1169810339 20:9603407-9603429 CTTGGAGTCTTCAGGGAATGAGG - Intronic
1169905385 20:10598143-10598165 CTGAGGGACTTCAGGGACTAGGG + Intronic
1171021049 20:21584426-21584448 GTGGGGCTCCCCAGGGAAGATGG - Intergenic
1171522482 20:25786431-25786453 CTGGGGGCCTGCAGGGAGGTCGG + Intronic
1171554345 20:26069452-26069474 CTGGGGGCCTGCAGGGAGGTCGG - Intergenic
1172071536 20:32260947-32260969 CTGGGAGCCTCCAGGGACGAGGG + Intergenic
1172215333 20:33231689-33231711 CGGGAGGGCTCCAGGGAAGATGG + Intergenic
1172227870 20:33317229-33317251 GTGGGGGTGGTCAGGGAAGGAGG - Intergenic
1172633286 20:36393163-36393185 CTGGGAGTCATTAGGGCAGAAGG + Intronic
1172814083 20:37672552-37672574 GTGGGGGGCTACAGGGCAGAAGG + Intergenic
1172946447 20:38693177-38693199 CTGGGGGCCTGCTGGGAGGAGGG - Intergenic
1173396976 20:42689085-42689107 CTGTGGGTCTTCAGGCTTGAGGG - Intronic
1174135685 20:48377415-48377437 GTGGGGGTCTTGTGGGAAGGTGG - Intergenic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1174580355 20:51567047-51567069 CTGGAGGTATTCACGGAAGTTGG + Intergenic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1175617999 20:60419898-60419920 CTGGGTGTTTTCAGTGATGAAGG + Intergenic
1175807613 20:61838473-61838495 ATGGGAGCCTTGAGGGAAGAAGG - Intronic
1176170118 20:63692962-63692984 CTTGGGGTCCTCAGCAAAGAGGG - Exonic
1176656285 21:9591409-9591431 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1179723575 21:43329640-43329662 CTGGGGGTCCTCTGGGTTGAGGG + Intergenic
1179830814 21:43994779-43994801 CTGGGGGTCTCCAGGGTACCTGG + Intergenic
1179874928 21:44262593-44262615 ATGGGGGCCTTCAGGGGAGGTGG + Intergenic
1179875026 21:44262871-44262893 ATGGGGGTGTTCAGGGGAGGTGG + Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181484736 22:23223601-23223623 CAGGGGGTACTCAGGGAGGAGGG + Intronic
1182320331 22:29474858-29474880 CTGGTTGTCTTGAGGGAAGGAGG - Intergenic
1182440545 22:30361398-30361420 ATGAGGGTCTTCAGGGGAGGAGG + Intronic
1183279875 22:36926246-36926268 CAGGGAGTCTTCAAGGCAGAAGG + Intronic
1183370580 22:37429484-37429506 CTGGAGGTCTCCAGGGAGAAGGG - Intergenic
1183544531 22:38448538-38448560 CTGGGGATTTTCTGGGGAGAAGG + Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184784819 22:46666599-46666621 CTGGGGCCCTTCTGGGCAGAGGG - Intronic
1185236422 22:49716217-49716239 CTGGGGGCCCTCAGGGCAGATGG - Intergenic
949808321 3:7978786-7978808 CTGCGGGTCTTCAGGCTTGAGGG + Intergenic
949906780 3:8864414-8864436 CTGGGGGTATTCACGAAGGAGGG + Intronic
950419154 3:12886753-12886775 CTGGGGGTGCTACGGGAAGAAGG + Intergenic
953241715 3:41155422-41155444 CTCGGGGTGTGCAGGGAAAAGGG + Intergenic
953912701 3:46900942-46900964 CTGGGGGTCATCGAGGATGAGGG + Intronic
954422783 3:50427338-50427360 CTGGGGGTCCCCAGGGATGGGGG - Intronic
954624609 3:52015784-52015806 CTGGTAGCCCTCAGGGAAGATGG - Intergenic
954854882 3:53635460-53635482 TTGGGGGGGATCAGGGAAGATGG + Intronic
955319646 3:57965063-57965085 CTGTGGGTCTACAGGTAAGTGGG + Intergenic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
955417345 3:58704836-58704858 CTGGAGGTGTTCAGGCAAGAAGG + Intergenic
956090158 3:65657777-65657799 CTGGGGGTCATCATGCAAGGTGG - Intronic
956900113 3:73706885-73706907 CTGGGGGTCTTCTTCCAAGATGG + Intergenic
957219494 3:77363738-77363760 ATGAGGGTCTTCAAGGAAGAAGG + Intronic
957655903 3:83075056-83075078 TTGGGAGTCTTCAGAGAAAAGGG + Intergenic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
959060381 3:101611294-101611316 CTGGGGGTGATCAGCGAAAAGGG - Intergenic
959063367 3:101635155-101635177 CTGGGGCTCTTCAGAGAAGGGGG - Intergenic
959908220 3:111733604-111733626 CTGGAGGTCTATGGGGAAGAAGG + Intronic
960507671 3:118513165-118513187 AAGAGGGTCTTCAGGGGAGAAGG - Intergenic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961053591 3:123767800-123767822 GTGGGTGTCTTCAGGGGAGTGGG + Intronic
961290110 3:125839921-125839943 ATGAGGGTCTTCAGCAAAGATGG + Intergenic
962371379 3:134823452-134823474 CTGGGGGTCTTGGGGAAGGAAGG + Intronic
962975034 3:140438880-140438902 CTGAGGGTCTTTAGGGTTGAAGG + Intronic
963206512 3:142641764-142641786 CTGGGTTTCTTTAGGGGAGATGG + Intronic
963364159 3:144313344-144313366 CTGGGTGTCTACAGGAAAGAAGG - Intergenic
965125682 3:164626585-164626607 ATGAAGGTTTTCAGGGAAGAAGG - Intergenic
965457688 3:168924344-168924366 ATTAGGGTCTTCAGGGGAGAAGG - Intergenic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967887993 3:194346223-194346245 CCCGGGCTCTGCAGGGAAGATGG + Intronic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
969350109 4:6593480-6593502 CCAGGGGTCTGCAGGGAAGGAGG - Intronic
969428777 4:7140877-7140899 CTGGGGCTCTTCCAGGATGAGGG + Intergenic
969515761 4:7647457-7647479 CACGGTGTCTTCAGGGATGAAGG - Intronic
969798129 4:9541789-9541811 CTGGGGGCCTTCAGGAAGCATGG + Intergenic
970369801 4:15395254-15395276 CTGGGGTGATTTAGGGAAGAGGG + Intronic
971910670 4:32792985-32793007 GTGGGGAACTTCAGGGAAGGTGG - Intergenic
972691500 4:41403202-41403224 CTGGGGGTGGTGGGGGAAGATGG + Intronic
973746343 4:53966878-53966900 GAGGGGGTCTTCAGAGAAAAGGG - Intronic
973822088 4:54670753-54670775 ATGAGGGTCTTCCAGGAAGAAGG - Intronic
974109628 4:57511317-57511339 GTGGGGGTTCCCAGGGAAGAGGG + Intergenic
975113305 4:70650738-70650760 CTGTGAGCCTTCAGGGAAGCTGG - Intronic
975630507 4:76396992-76397014 CTGGGGGCCTTCTTGGGAGAAGG + Intronic
976266527 4:83190577-83190599 ATGAGGGTCTCCAAGGAAGAAGG + Intergenic
980515159 4:133847676-133847698 ATGAAGGTCTTCAGGGGAGAAGG + Intergenic
981601706 4:146496505-146496527 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
982074985 4:151730157-151730179 ATGCGGGTTGTCAGGGAAGAAGG - Intronic
982678204 4:158400140-158400162 ATGAGGGTCTTCAAGGTAGAAGG - Intronic
982774392 4:159427263-159427285 CTGGGGGTCTTCAGGTGTGATGG - Intergenic
983060076 4:163149871-163149893 TTGGGGGACTGCAGAGAAGAGGG + Intronic
984410027 4:179386186-179386208 CTGAGCATCTTCAAGGAAGAGGG - Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
985273214 4:188214174-188214196 CTGTGGGTTTTCTGGGAAGTGGG - Intergenic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985556167 5:559002-559024 CTGGTGGTCCTCACGGAGGATGG + Intergenic
985556206 5:559148-559170 CTGGTGGTCCTCACGGAGGATGG + Intergenic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG + Intergenic
985746297 5:1650460-1650482 CTAGAGGTCTTACGGGAAGAAGG + Intergenic
985836335 5:2274828-2274850 CCGGGGGTCAGCAGGGAGGAGGG + Intergenic
986089916 5:4493922-4493944 CTGGGGGTTTTCAGGGAGACTGG - Intergenic
991486759 5:67145257-67145279 ATGGGGGTCTCCAGGGCAGGAGG - Exonic
993018607 5:82564200-82564222 ATGAGGGCTTTCAGGGAAGAGGG - Intergenic
993413741 5:87601234-87601256 GTGGGGGTTCCCAGGGAAGAGGG + Intergenic
994994233 5:107039191-107039213 ATGAGGGTCTTCAGGGGAGAAGG + Intergenic
995599850 5:113783425-113783447 TTGAGGGGCTTCAGGAAAGATGG + Intergenic
997259743 5:132456775-132456797 CTGAGGGTCTACAGGCCAGAGGG - Intronic
997414345 5:133713608-133713630 CAGGGGGTATCCTGGGAAGATGG - Intergenic
997529121 5:134571359-134571381 CTGGAGGTTTTAAGGGGAGAAGG + Intronic
997639425 5:135438950-135438972 CTTAAGGCCTTCAGGGAAGATGG + Intergenic
998214624 5:140227775-140227797 CTGGGGGTCCTCATGGCAGAAGG - Intronic
998291170 5:140916168-140916190 CTGGGACTCTTCAAGGAAGTGGG + Intronic
999434560 5:151553209-151553231 GTGGGGGTCATCAGCGTAGAGGG - Exonic
999811016 5:155127099-155127121 CTGTGGGTCTTCAGGCTTGAGGG + Intergenic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1001115267 5:168934101-168934123 CTGGTGGGCTTCCGGGAAGCAGG - Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002130675 5:177079728-177079750 TTGGTGGTCTCCAGGGAAGCGGG - Intronic
1002581789 5:180213050-180213072 GTGCGGGTCCTCAGGGAGGAAGG + Intergenic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1002698712 5:181107672-181107694 GTGGGTGTCTCCCGGGAAGACGG + Intergenic
1003867138 6:10373455-10373477 TTGGGGGGTTTCAGGGAAGTGGG + Intergenic
1003923751 6:10857486-10857508 CTGAGGTTCCTCAGAGAAGAAGG + Intronic
1005010302 6:21329349-21329371 ATGAGGGTCTTCAGGGGAAAAGG - Intergenic
1006026125 6:31148316-31148338 CTGAGGATCCTCAGGCAAGAGGG - Intronic
1006391816 6:33763089-33763111 TAGTGGGTCTTCAGTGAAGAGGG + Intergenic
1006501032 6:34458861-34458883 AGGAGGGTCTTCAGGAAAGAAGG + Intergenic
1007041107 6:38723119-38723141 CTGGAGGACCTCCGGGAAGACGG - Exonic
1007118332 6:39360365-39360387 CTGGGGAACATCAGGGAAGCTGG - Intronic
1007652664 6:43432905-43432927 CTGGTGGGCTTCCTGGAAGAGGG + Exonic
1007872285 6:45053955-45053977 CTGATGGTCTTCAGGGGAGAAGG - Intronic
1009027361 6:58016047-58016069 ATGAGGGTCTTCAGGAGAGAAGG - Intergenic
1010052856 6:71527924-71527946 CTGGGAGTCTTTAAGAAAGAAGG - Intergenic
1010972044 6:82273349-82273371 ATGAGGATCTTCAAGGAAGAAGG + Intergenic
1013079416 6:106799456-106799478 CAGGGGGACTCCAGGCAAGACGG + Intergenic
1013328558 6:109073490-109073512 CTGTGGGTCTTAGGAGAAGACGG - Intronic
1017795470 6:157840268-157840290 CTGAGGGAGCTCAGGGAAGAGGG + Intronic
1017837193 6:158189242-158189264 CTGGGGGTTTCTATGGAAGAGGG - Intronic
1018674496 6:166207146-166207168 TGGTGGGTCTTCAGGGAAGCCGG - Intergenic
1019374381 7:681577-681599 CTGGAGGTCTGCTGGGAGGAGGG + Intronic
1019462234 7:1166573-1166595 CTTGTGGTCAGCAGGGAAGAAGG + Intergenic
1019577186 7:1743255-1743277 CTGAGGGTCTCCAGGCAGGACGG - Intronic
1020140775 7:5610530-5610552 TCAGGGGTCTTCAGGGAAGCCGG - Intergenic
1020331096 7:7017679-7017701 CTGAGGCTCTTCAGTGAAGCAGG + Intergenic
1021222116 7:17986282-17986304 GTGGGGGCTTTCAGGGAAGGAGG - Intergenic
1022135379 7:27442700-27442722 ATGAGAGTCTTCAAGGAAGAAGG - Intergenic
1022359281 7:29643298-29643320 CTGGGGCTTTTCAGAGAAGGGGG + Intergenic
1022797357 7:33742703-33742725 ATGGGCGTCCTCAGGGAAGCAGG + Intergenic
1023659422 7:42457226-42457248 CTGGGTGGCTTCAGGAAGGAAGG + Intergenic
1024010969 7:45266449-45266471 CTGGGTGTCTTCAGCGATGGAGG + Intergenic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024292110 7:47812260-47812282 CTGGGCTGCTGCAGGGAAGAGGG - Intronic
1024426246 7:49229580-49229602 CTGAAGGTTTTCAGGGAAAATGG + Intergenic
1024554095 7:50588570-50588592 CTTGGGGTCCTCTGGGAACAAGG - Intergenic
1024996362 7:55275757-55275779 CTGGGGGTCATCCTGGAAGCTGG - Intergenic
1026385173 7:69839688-69839710 GTGGGGGTATTCAGGAAAGCAGG + Intronic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1027766796 7:82354026-82354048 ATGAGAGTCTTCAGCGAAGAAGG - Intronic
1028803326 7:94994291-94994313 CATAGGGTCTTCAGGGGAGAAGG + Intronic
1029298894 7:99562975-99562997 CTGGGGATCTTAAGGGGTGAGGG - Intronic
1029603373 7:101583185-101583207 CTGGGGTCCCTCAGGGATGAGGG + Intergenic
1030172617 7:106619083-106619105 CTTGGGGTCTTCAAGGAAATTGG + Intergenic
1030703337 7:112665895-112665917 GTGGCAGTCTTCAGGGAAGCTGG - Intergenic
1031009395 7:116509770-116509792 CTTGGGTTCTGCAGGGATGACGG + Intergenic
1031121425 7:117726792-117726814 CTGTGGGGCTTCAGGGATAAAGG + Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032100508 7:128972687-128972709 GTGGGGGGTTTCAGGGAAGAAGG + Intronic
1032529740 7:132610244-132610266 CTGGGGAATTTCTGGGAAGATGG + Intronic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033832667 7:145272325-145272347 GTGAGAATCTTCAGGGAAGAGGG + Intergenic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1037504161 8:19514254-19514276 CTGGAGGGGGTCAGGGAAGAAGG - Intronic
1038491929 8:27977628-27977650 CTGGGGGTTTTTAGGGAGGAAGG - Intronic
1039062892 8:33585776-33585798 CTGGAGGTGATAAGGGAAGAAGG + Intergenic
1039484198 8:37898857-37898879 CTTTGGGTCTTCTTGGAAGAAGG - Intronic
1042374852 8:68038642-68038664 CTGGGATTCTTGAAGGAAGAGGG - Intronic
1042907596 8:73787855-73787877 CTGAGTGTTTTCAGTGAAGATGG - Intronic
1046481268 8:114821617-114821639 CTGGGGCTCTACAGGGCAGTGGG + Intergenic
1047211252 8:122842266-122842288 CTGGGGGCCCTGAGAGAAGAAGG - Intronic
1047715533 8:127591636-127591658 CTGGAGGACCTCAGGGAGGAGGG + Intergenic
1047768745 8:128013067-128013089 CAGGATGGCTTCAGGGAAGAAGG - Intergenic
1048020763 8:130537050-130537072 TTGGGAGTCTCCTGGGAAGAAGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049193819 8:141304599-141304621 CTTGGGGACTTCAGGTGAGAGGG - Intronic
1049702310 8:144020834-144020856 GAGAGGGTCTTTAGGGAAGAGGG - Intronic
1049702443 8:144021300-144021322 CAGAGGGTCATGAGGGAAGAGGG - Intronic
1049702804 8:144022770-144022792 AAGTGGGTCCTCAGGGAAGAGGG - Intronic
1049702820 8:144022834-144022856 GAGAGGGTCCTCAGGGAAGAAGG - Intronic
1049702854 8:144022982-144023004 AAGAGGGTTTTCAGGGAAGAGGG - Intronic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049702974 8:144023383-144023405 AAGAGGGTCCTCAGGGAAGAGGG - Intronic
1049702992 8:144023447-144023469 GAGAGGGTCCTCAGGGAAGAAGG - Intronic
1049703335 8:144024715-144024737 AAGAGGGTCGTCAGGGAAGAGGG - Intronic
1049703339 8:144024731-144024753 AGGAGGGTTTTCAGGGAAGAGGG - Intronic
1049703361 8:144024800-144024822 AAGAGGGTCCTCAGGGAAGAGGG - Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1051726142 9:20089531-20089553 GTGGGGGTTCCCAGGGAAGAGGG - Intergenic
1051822170 9:21181135-21181157 ATGGGGATTCTCAGGGAAGAGGG - Intergenic
1051825224 9:21211733-21211755 ATGGGGATTCTCAGGGAAGAGGG - Intronic
1052009204 9:23385952-23385974 CTGGGGGACTACAGGGAAGGTGG + Intergenic
1052971697 9:34380794-34380816 CTGGGGGCCTGCACGGAAGCTGG + Intronic
1054810844 9:69432735-69432757 CAGGGGGCTTTCAGGAAAGACGG - Intronic
1055502588 9:76916392-76916414 ATGAGTGTCTTCAGGGGAGAAGG - Intergenic
1055623314 9:78148079-78148101 TTGGGTTTCTTCAGGTAAGATGG + Intergenic
1056953924 9:91067458-91067480 TTGGGAGTGTTCAGGAAAGAAGG + Intergenic
1057159978 9:92882637-92882659 CTGGGGGTGTTTAGCGATGAGGG - Intergenic
1057171702 9:92966753-92966775 CTGGGGGTGTCCAGGGGAGGCGG - Intronic
1057220955 9:93257460-93257482 CTGGGGTCCTTCAGGGAGGGCGG + Intronic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057946421 9:99333525-99333547 CTGGGGGTACTCAGGGATGCTGG + Intergenic
1058113540 9:101058076-101058098 CTAGGTGTGTTCAAGGAAGAAGG - Intronic
1058873035 9:109218775-109218797 CTGGAAGTCTTCCTGGAAGAAGG - Intronic
1060218525 9:121752524-121752546 CAGGAAGGCTTCAGGGAAGAAGG + Intronic
1060333782 9:122702442-122702464 ATGGTGGTTTCCAGGGAAGAGGG + Intergenic
1060404804 9:123367933-123367955 GGGATGGTCTTCAGGGAAGACGG + Intronic
1060888033 9:127169293-127169315 CTGGGGCTCTACGGGGAAGGAGG - Intronic
1060969921 9:127732091-127732113 CTGCTCGTCTTCAGGGAAGAAGG + Exonic
1061057858 9:128233746-128233768 CTGGGCAACTTCAGGGCAGAGGG - Intronic
1061244587 9:129394901-129394923 TTGGGGGTCTGCTGGGCAGAGGG - Intergenic
1061270265 9:129536344-129536366 GTGGCTGGCTTCAGGGAAGAGGG + Intergenic
1061358997 9:130128957-130128979 CTGGGTCTTGTCAGGGAAGATGG + Intronic
1061465813 9:130778575-130778597 TTGGGGCTCTTCTGGGCAGATGG + Intronic
1061532898 9:131228774-131228796 CTGGGGGGCTGCAGGGGAGCAGG - Intronic
1061714987 9:132513448-132513470 GGGAGGGTCCTCAGGGAAGACGG - Intronic
1062343296 9:136103385-136103407 CTGGGGGTCTCGAGGGACGGAGG - Intergenic
1062448649 9:136606394-136606416 CTGGGCGTCTGCAGGGCGGAGGG - Intergenic
1203634001 Un_KI270750v1:94891-94913 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1185728338 X:2441087-2441109 CCGGCTGTCTTCAGTGAAGACGG + Intronic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1186645798 X:11506107-11506129 GTGGGAGACTTCAGGGAGGAGGG - Intronic
1186685880 X:11923494-11923516 GTGAGTGTCTTCAGGGAAGCAGG + Intergenic
1186798802 X:13072382-13072404 CTGGGGGCCTCTAGTGAAGAAGG + Intergenic
1189635879 X:43008641-43008663 CTGGCCTGCTTCAGGGAAGAAGG + Intergenic
1189861143 X:45273691-45273713 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1192682304 X:73264292-73264314 ATGGAGCTCTTCAAGGAAGAAGG + Intergenic
1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG + Intergenic
1194187871 X:90795460-90795482 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1195858801 X:109358703-109358725 CTCTGGGTCTTCAGGGATCACGG + Intergenic
1199511672 X:148629876-148629898 CTGGGGGTTCACAGAGAAGAAGG - Intronic
1199677350 X:150199559-150199581 ATGGGTATCTCCAGGGAAGAAGG - Intergenic
1199869303 X:151882868-151882890 CTGGGGCTTTTCAGGGAATGGGG + Intergenic
1200534459 Y:4377409-4377431 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1201742373 Y:17337613-17337635 CTGGGGGTCAGCAGGGCTGAAGG + Intergenic