ID: 1134696510

View in Genome Browser
Species Human (GRCh38)
Location 16:16228518-16228540
Sequence TATCACACCCACTTTGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134696510_1134696513 12 Left 1134696510 16:16228518-16228540 CCAATATCAAAGTGGGTGTGATA No data
Right 1134696513 16:16228553-16228575 GATATTATTCCTAATATCCGTGG No data
1134696510_1134696514 13 Left 1134696510 16:16228518-16228540 CCAATATCAAAGTGGGTGTGATA No data
Right 1134696514 16:16228554-16228576 ATATTATTCCTAATATCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134696510 Original CRISPR TATCACACCCACTTTGATAT TGG (reversed) Intergenic
No off target data available for this crispr