ID: 1134706434

View in Genome Browser
Species Human (GRCh38)
Location 16:16306715-16306737
Sequence CTGGAGGCAGAGCTGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134706434_1134706440 -7 Left 1134706434 16:16306715-16306737 CCTGTCTCCAGCTCTGCCTCCAG No data
Right 1134706440 16:16306731-16306753 CCTCCAGGAAAGCCGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134706434 Original CRISPR CTGGAGGCAGAGCTGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr